MEGAResFrom MEG, the Microbial Ecology Group

Notice: Trying to access array offset on value of type null in /home/meglabuser/megares.meglab.org/vendor/doctrine/annotations/lib/Doctrine/Common/Annotations/DocParser.php on line 967

BLAA

The blaA gene encodes an Ambler class A beta-lactamase.

References

  • http://www.ncbi.nlm.nih.gov/pubmed/11897607

Notice: Trying to access array offset on value of type null in /home/meglabuser/megares.meglab.org/vendor/doctrine/annotations/lib/Doctrine/Common/Annotations/DocParser.php on line 967

Other Groups in Class A betalactamases

Sequences

Download Sequences

>>MEG_1239|Drugs|betalactams|Class_A_betalactamases|BLAA
atgaaacattcttcgctgcggcgttcgttattattagccggtattaccctccccttggtcagttttgcactaccagcttg
ggcaaatgcgctaccggcttcagtagataaacaattagccgagcttgaacgaaatgccaatggccgtttaggtgtcgcga
tgattaataccggcaatggcaccaaaattttgtatcgcgcagctcaacgtttcccattctgtagtacttttaagtttatg
ctggccgctgctgtattagatcaaagccagtctcagccgaatttactcaataagcatataaattaccatgagagtgattt
gttatcttatgcccccatcacgcgtaaaaatcttgcgcatggcatgaccgtctccgaattatgtgctgccaccattcaat
atagtgataacactgccgcaaatttattaattaaagagttgggtggtttagcggctgttaatcagttcgctcgcagtatt
ggcgatcagatgttcagattagaccgctgggagcctgatttaaataccgcgcgacctaatgacccacgtgataccaccac
tcctgcggctatggcagcgagtatgaataaattggtgttgggtgatgcattgcgccctgcccaacgaagtcaactcgctg
tatggctgaaaggaaataccactggggatgccacaattcgtgcgggtgcccctactgactggattgtgggtgacaaaacg
ggtagtggcgattacggaaccaccaatgatattgcggtactttggccgactaaaggcgcgccgattgttttagtcgtgta
tttcacgcaacgcgaaaaagacgcgaagccacgccgcgacgtattggcctctgtgaccaaaataattttgtcgcagatat
cctga

>>MEG_1240|Drugs|betalactams|Class_A_betalactamases|BLAA
atgaaatttcaatgtcattttctctctgtccctgtggcgatactcggatgtgttggcctcatctgcacatccgcatatgc
catggatacgggaatcctcgacctcgctgtaacccaagaggagaccacgcttcaggctagggtcggagtggcggtgatcg
atacggattccggcctgacgtggcagcatcgtggcgacgaacgcttcccgctgaacagcacgcataaagccttttcctgc
gcggccgttctggcccaggccgaccgccacaagctgaacctggagcaggcgataccgatcgagcgcacagcgctggtcac
atactcacccgtgacggaaagggtgccacctggcggcacgctgaccctgcgtgagctgtgcagggccgccgtcagtatca
gtgacaacacagcggccaatttggcgttggatgcaatcggcggggcacggacattcaccgcgttcatgcggtctatcggt
gacgataagacacgcctggatcggcgagaacccgaactcaacgaggccacgccgggggatgcacgcgacacgacaacgcc
aattgcggcagcgcggagcctgcaaacactgttgctcgacggtgtcctctccgctccggctcggaacgaactgacacaat
ggatgctcggggatcaagttgccgatgccttgctacgcgctggcttgccgagggattggcaaattgcggacaagtcggga
gcaggtggtcacggatcacgttccataatcgccgttgtctggccgcccaagcgttcagccgtcattgtggcgatctacat
cacccaaaccgcagcgtctatgtcggcaagcaaccaggcggtgtccagaatcggatcagccttagcaaaggcgttgcaat
ga

>>MEG_1241|Drugs|betalactams|Class_A_betalactamases|BLAA
atgaagcactcttcgctacggcgttcactattattagccggtattaccctgcccttagtcaattttgcgctgccaacctg
ggccgctgcgattccgggatcattagacaagcaattggcagcacttgagcatagtgctaacggtcgtttaggcattgcga
tgattaatagcggcgctggcaccaaaattttgtatcgcggagctcaacgtttcccattctgtagtacttttaagtttatg
ctggccgctgctgtattagatcaaagccagtctcagccaaatttactcaataagcatataaattaccatgagagtgactt
gttatcttatgccccgatcacgcgtaaaaatctggcgtgtggcatgaccgtctccgagttatgtgctgccaccattcaat
atagtgataacactgccgcgaatttattaattaaagagttgggtggtttagcggctgttaatcagtttgctcgcagtatt
ggcgatcagatgttcagattagaccgctgggagcctgatttaaataccgcgctacctaatgacccacgtgataccaccac
tcctgcggctatggcagcgagtatgaataaattggtgctgggtgatgcattgcgccctgcccaacgaagtcaactcgctg
catggctgaaaggaaataccaccggggatgccacaattcgtgcgggtgcccctactgactggattgtgggtgacaaaacg
ggtagtggcgattacggaaccaccaatgatattgcggtactttggccgactaaaggcgcgccgattgttttagtcgtgta
tttcacgcaacgcgaaaaagacgcgaagccacggcgcgatgtattggcctctgcgacccaaataattttgtcgcaaatat
cctga

>>MEG_1242|Drugs|betalactams|Class_A_betalactamases|BLAA
atgcgcaacagaggattcggtcgtcgcgaactgctggtagcgatggcaatgctggtttccgtgacggggtgtgcacggca
tgcgagcggggcccgtccggcatcgacaaccttgccggccggagcggatctggcggatcgcttcgccgagctggagcgca
gatacgatgcccggcttggggtgtatgtgcccgccaccggcaccaccgccgcgatcgaataccgcgccgatgagcggttc
gcattctgctccacgttcaaggcgccgctcgtggcggcggtgctgcaccaaaacccgctcacgcatctggacaaactgat
cacctacaccagtgacgacattcggtcgatctccccggtggcccaacaacacgttcagaccgggatgacgatcgggcagc
tttgcgatgcggcgatacgctatagcgacggcaccgccgccaacctgttgctggccgatcttggcggtcccgggggcggc
accgcggcatttaccggctacctccgcagcttgggtgacaccgtgagccggttggacgccgaggaaccggagttgaaccg
cgatccgcccggggacgaacgggataccacaacaccgcacgccatcgccctggtgttgcagcagcttgttctcggcaacg
cgttgccgcccgacaagcgggcactgctcaccgattggatggcgcgcaacaccaccggagccaagcggatccgagcgggc
tttcccgccgattggaaggtgatcgacaagaccgggaccggtgactacggacgagcaaacgacatcgcggtcgtgtggtc
accgaccggcgtgccctacgtggtggccgtcatgtccgatcgtgccggcggcgggtatgacgccgagccccgtgaggcgc
tgctcgccgaggcggcgacgtgcgttgccggtgtgcttgcatag

>>MEG_1243|Drugs|betalactams|Class_A_betalactamases|BLAA
atggtctcgttggttgttcgttcctgttccgttgctgctgttgcagtcggtctgctgtttcccgcctgcgctgcgcctgt
cggcgccaccgccaccactgcccccgttgccgagttagacagcgtgccgcaagttagcagtggtcgcttaggcgtggcga
ttctggatttccagacgtcgaaaacgtatcacataaacggcaaagatcggttcccgatgcagagcgtgtttaaggcgatg
tcggcggtggtggtgatgcgggaggtggatgaggggaagctgacgctggatcaggagattccggtggggccagatgatat
ctcggtttactggagtcccatcgcggaggaatttaaaggtaccacgcagacatatacggttcgtgaactactggagaagt
cagtgggcatgagcgataacaccgcggcggatgtgctgatggaactgacgggcggtccgcaggcggtgacgcagttgctg
aaggatgccggtattgagggcgtgcgggtagaccgctatgagcggcagttccaggcggaactggaaggcctgccgccgtt
tgagctgggtgaggtgatcaaccgaaaagcatttgtcgaagcggcgaaggcggtgccggctgaggtaaagcgcccgatat
tggaacgctacgtggctggcaaggatgagcgcgatacggccactcccctgggcgccgtggatttcctggtgaagctgcag
gagggcaagctgctctcggcagaatcgacgcgggtgctgctgcagatcatgacggatgtgaagactggggctgggagact
aaaagctggattgcccgagggcagtaagctggcgcataagacgggcaccggcggcgacatcctgggcgtgaacacagcga
cgaacgacatcgggatcgcaaccctgccggacgggcggaagttcgccgtggcggtgtttctgacggggtcgaaggagtcg
gaagagaagcgagacgccatccacgcagacgtggtgcggcagtttgtagatcagctgctggcggaagcgaaagagtaa

>>MEG_1244|Drugs|betalactams|Class_A_betalactamases|BLAA
atgaaaagaatatttccggcttacattctgcttacagctttcctactggcctgctccagcaacgccacgactcaaaatgc
taatcaatcaaacaagcccgccgctgctcaggaagcaaaggcggatgataagcagaaccgcgagctgcaaaaacagatag
agcagatagcttcagcggcacgcgggcgcgtgggcgttcatgcggtcgtgctggaaacgggtgaatccgtctccctggat
gagcagggccgatttcctatgcagagcgtttataagttcccgattggcatggctgtactcgcgcaagtagatgccggaaa
gctaaagcttgacgagcgcgtgcgcgttgaaaagagcgaatacgttagagagggcatgcacagccccttgcgagacaaaa
atccgaacgaagctgaggtgagcgtgcgcgagttgctgcgattagctgtctctgaatcggacggtacggcgagcgatgtg
ctgttcagactggcgggcggcagcgaagcaatcaccagatacctcagcgaccttaaggtcacagagattatcgtagccga
cacggagaaagagatagggcaggactgggacactcagtatcgcaactgggcttcgcccaagggagcagttatgcttctac
gcgcattccatgaggggcgcgggctctccgcagagagcagggcgctcttgctgaaattgatgactgacacccctaccgga
ccgaaaaggctgaaaggacttttgcctaagggcacagtcgtcgcgcacaagaccggaacatctggagcaaacgctagcgg
catcagcgccgcgaccaacgatataggaatagtgacgctgccgaacggtcgccatctggccatagccgttttcgtttccg
attctccggccgatctaaccacgcgcgagggcgtgattgccaaagtcgctaaggctgcgtgggaccagtggggaaagtaa

>>MEG_1245|Drugs|betalactams|Class_A_betalactamases|BLAA
ATGAAAAAAATAATTACGCTGATAATTGGTATAATATTTATAACTTTTAGTTTTGCTACTACAAAAATAGATACCCAAGT
TACCAATGATATTCAAAATATAGAAAAAAAACATGGTGGTAAAATTGGTGTATATACTATAAATCGAAATGACTGGAGTA
ATTTTGCAGTCAATGCTAGCTTCTACTTTCCAATATGTAGTACTTATAAATTTCTTGTAGTTGGTGCAATACTTAAACAA
AGTATGACTGATAATAAACTACTTAATCAAAAAATCAAAATCTCAAAAAATCAAATTGTTGAGTATTCCCCTATTACAAG
AAGGCATATTAATCAAATAATGACTGTGAAACAACTTTGCCAAGCATCTATGCAAGGGGATAATACTGCGACAAATATCC
TAATTGAAAAACTAGGTGGTTTGAAAAATCTCAATAAGTTTATCTTATCGCTTGCAGATCATGCGACAAAAGTCGCTAAT
TTAGAGCCTAAAGTCAATCATGTCAGCCTAACGACAAACGAAAATAAGACCACTCCCAAGATTATGGCAAGAGATATTAA
TAAACTTGCTTTTAGCGATGATATACTTGATAAAAAACATCGCTTAATGTTTAAACAATGGCTAATAGCGAGTAATACTA
GCAACAATCGTATAGCTGCTGAGGTGCCTGATGAGTGGGAAGTTGGTGATAAAACTGGAACTTGTCAATATGGTACAACA
AATGATGTTGCTATTATTTGGCCTGATGATAATAGAGCTGTTATTATGGCAATTTTTTATACCCAATCGCAAAAAAATGC
TAAACCAAACAGTAAAATTGTTAGAGAGGTAACTAAAATACTGCTAAACAGACTACAATTAAACAATACTACGAAAAATG
CCTAA

>>MEG_1246|Drugs|betalactams|Class_A_betalactamases|BLAA
ATGACTATTTCAAACACAACAGACTTGCCTGCTCCCTTAATGCCATCACAGCAACACAATGGCAAATTTAGAAATACGCG
TCCGAACCAACACAAGCCTTCTTTTGGCAAAACGCTTCAACTCATGTGGAAGTTTCTATTTAACAAACCTAAAAATACCG
TTCCAAACAGAGAAATTCCTGTTTTAAGTTTGTCAAAAGAACAGCTTTTAAGTGCGCCTGACCGTTCTCTATTTCGTTTG
GGTCACTCAACTATCCTGTTAAAACTGCAAGATGAATTTTGGTTAACTGACCCTGTTTTTTCAGAGCGTGCATCACCTTT
TCAATGGCTTGGACCAAAACGTTTCCATCAGCCCCCAATTAGTATTGCCGAATTACCACCCATTAAAGGCGTGATTTTGT
CGCATAACCACTACGACCACCTCGATTACCATGCGGTCATGCAGCTTAACGATAAAGTTGAGCACTTCTTAACACCGCTT
GGTGTGGGTGATACACTCATTAAATGGGGAATTCCAGCAGAAAAGGTTCAGCAGCTCGACTGGTGGGGTACCACACAGGT
AGATGGACTAAAATTAGTTGCTACCCCTGCCCATCATTTTTCAGGCCGTGGTATGGGTGATAGCAATGCGACACTTTGGG
CATCGTGGGTGATTATTGATAATGATTTACGTGTATTTTTTAGTGGAGATACGGGCTATTTTGACGGGTTTAAAGAAATC
GGTCTTCGTTATGGACCTTTCGATCTGACCATGTTAGAAACGGGTGCTTACGACCCCGAATGGCCTGATGTTCACATGCA
ACCAGAGCAAACTTTACAAGCTCATATCGATTTAAAAGGACGTCATTTGTTGCCTGTGCACAACGGTACTTTTGACTTGG
CACTTCATGCTTGGGACGACCCTTTTGAACGTATCGTCGCTTTGGCTCAACAAAATAATTTAGCGATTAGCACACCGCAA
ATGGGACAAATTTTGAACTTAAACGAGCCGAATGTTGAAAATTATTGGTGGCGTTCGTGA

>>MEG_1247|Drugs|betalactams|Class_A_betalactamases|BLAA
ATGAATCTGAATATAAGAGGACATTTAATGAAGAACTTTCTCACCAAGAAAATGTACGCAACTAGAGCTTTATTTTTTGC
TGTAGGTGTTACGGCTTTGAATGTTTCCCCTATTGTTATTTCTACTACTCATGCAGCGACAGAACAAAAAATGGATAATT
TATCGACTACACTTTCATTAATTTTTGCAGATAAACCCATAGAAGCTTCTTTATTTAGCCCTCAATTTTTAGGACAAGTT
CCCATCACACAAATTCAAAAAATCGTTGATGATTTAAAAGTCTCTTTAGGTGCTCTTAAAAATATTAATGTTTCAAATGG
CTCTGGGACTATTGATTTCGAAAAGGGAGAATTACCCGTTTCAATTAGCTTAAATGAGCAAGAACAAATTAGTACTCTTT
GGTTTAGTGCGCCTCATTTTAAGACAATAAGCCTAGACGAAATGGTTAAAGGTCTACATGAAAATGCGATCGGTAAAACT
TCTCTTTTAGTTATTGTAGATAACAAGCCTGTGGTTGTAGAAAATGATAAAACCCCTATGGCTGTCGGTTCGACTTTTAA
GTTACTAGTTTTAAAAGCTTATGAAGATGCGATAAAAAAAGGCGAATTAAAAAGAGAAACTATTGTTTCTTTAAAAGAAA
AGAATCGCTCGTTGCCAACAGGAGTTTTACAAAACTTGCCTGCTGGTACACCTATAAATCTCGAACTTCTTGCGCAGTTA
ATGATACAAATTAGCGATAATACAGCAACAGATAGCTTGATAGATGTATTAAAGAAACCTCGTATAGAAGCGTTGTCACC
TAGAAATTCTCCTCTGCTGACGACACGAGAGCTATTTCAACTGATTGATTCAAGTAATGAAAAGCTCAGAAATAAGTTTA
AAACAGGAACAAAGTCGGCTCGTCTGGAAGCACTCTCTGAGCTAGACAAACTGCCACTACCAAGTGTGAGTAGCATTGGA
AAATCGGCTACTTGGCAAGATGCTGAATGGTATATGTCAGCCCATGAGATTTGTCCTCTTCTTGAAAGTGTTCAAGATGC
TCCGGCTCTGAACAGTTCTTTAAATCCACTTTTTAAAAATTTAAATTGGCAAAAGATTGGTTTCAAAGGTGGTTCCGAAT
ACGGCGTCATCAACTTTTCTGTAATTGGAAAAACTCAAAAAGGTCATAACGTGTGTGCCGTATTTACCGCAAATGGAAAT
GAGCCACAACCCGAATCAAAACTAGCAATATTATTTACAGGCATACTTCAAGCTGTTGATTCTATGAGTCATTAG

>>MEG_1248|Drugs|betalactams|Class_A_betalactamases|BLAA
ATGAAGCACTCTTCGCTACGGCGTGCGCTATTATTAGCCGGTATTACCCTGCCCTTAGTCAATTTTTCGCTGCCAACCTG
GGCCGCTGCGATTCCGGGGTCATTAGACAAGCAATTGGCAGCACTTGAGCACAGTGCTAACGGTCGTTTAGGCATTGCGA
TGATTAATACCGGCAATGGCACCAAAATTCTGTATCGCGGAGCTCGACGTTTCCCATTCTGTAGTACTTTTAAGTTTATG
TTAGCCGCTGCTGTATTGGGTCAAAGCCAATCTCAGCCGAATTTGCTCAATAAGCATATCAATTACCATGAGAGTGATTT
GTTATCTTATGCCCCCATCACGCGTAAAAATCTGGCGCATGGTATGACAGTTTCTGAATTATGTGCGGCTACCATTCAAT
ATAGCGATAACACGGCCGCGAATTTATTACTTAAAGAGTTGGGTGGTTTAGCGGCTGTTAATCAGTTTGCTCGCAGTATT
GGCGATCAGATGTTCAGGTTAGACCGCTGGGAACCGGATTTAAACACCGCACTACCTAATGACCCACGTGATACCACCAC
TCCTGCGGCTATGGCAGCTAGTATAAATAAATTGGTATTGGGTGATGCATTGCACCCTGCCCAACGAAGCCAACTCACGG
CATGGCTGAAAGGAAACACCACCGGGGATGCCACGATTCGCGCGGGTGCCCCTACTGACTGGATTGTGGGTGACAAAACA
GGTAGTGGCGATTACGGAACCACCAATGATATTGCGGTACTTTGGCCGACGAAAGGTGCACCGATTGTTTTAGTGGTGTA
TTTCACGCAACGTGAAAAAGATGCGAAGCCACGTCGCGATGTATTGGCCTCTGCGACCAAAATAATTTTGTCGCAAATAT
CCTGA

>>MEG_1249|Drugs|betalactams|Class_A_betalactamases|BLAA
TTATTAGCTGGTATTACCCTGCCCTTAGTTAATTTTTCGCTACCTACCTGGGCTGCTGGGATCCCGGGATCATTAGACAA
GCAATTGGCAGCACTTGAGCACAGTGCTAACGGTCGTTTAGGCATTGCGATGATTAATACCGGCAATGGCACCAAAATTC
TGTATCGCGGAGCTCGACGTTTCCCATTCTGTAGTACTTTTAAGTTTATGTTAGCCGCTGCTGTATTGGGTCAAAGCCAA
TCTCAGCCGAATTTGCTCAATAAGCATATCAATTACCATGAGAGTGATTTGTTATCTTATGCCCCCATCACGCGTAAAAA
TCTGGCGCATGGTATGACAGTTTCTGAATTATGTGCGGCTACCATTCAATATAGCGATAACACGGCCGCGAATTTATTAC
TTAAAGAGTTGGGTGGTTTAGCGGCTGTTAATCAGTTTGCTCGCAGTATTGGCGATCAGATGTTCAGGTTAGACCGCTGG
GAACCGGATTTAAACACCGCATTACCTAATGACCCACGTGATACCACCACTCCTGCGGCTATGGCAGCTAGTATAAATAA
ATTGGTATTGGGTGATGCATTGCACCCTGCCCAACGAAGCCAACTCACGGCATGGCTGAAAGGAAACACCACCGGGGATG
CCACGATTCGCGCGGGTGCCCCTACTGACTGGATTGTGGGTGACAAAACAGGTAGTGGCGATTACGGAACCACCAATGAT
ATTGCGGTACTTTGGCCGACGAAAGGTGCACCGATTGTTTTAGTGGTGTATTTCACGCAACGTGAAAAAGATGCAAACCC
CGTTCCCGATGTATTGGCCCTTTGCCAACCAAAATATTTTGGCCGCAAATTTTGA