Warning: "continue" targeting switch is equivalent to "break". Did you mean to use "continue 2"? in /home/meglabuser/megares.meglab.org/vendor/doctrine/orm/lib/Doctrine/ORM/UnitOfWork.php on line 2640
MEGARes
MEGAResFrom MEG, the Microbial Ecology Group

Notice: Trying to access array offset on value of type null in /home/meglabuser/megares.meglab.org/vendor/doctrine/annotations/lib/Doctrine/Common/Annotations/DocParser.php on line 967

ARL

The ARL group of genes confer resistance to betalactams through the mechanism, Class A betalactamases.

References


    Deprecated: The behavior of unparenthesized expressions containing both '.' and '+'/'-' will change in PHP 8: '+'/'-' will take a higher precedence in /home/meglabuser/megares.meglab.org/src/Sequence.php on line 169

    Notice: Trying to access array offset on value of type null in /home/meglabuser/megares.meglab.org/vendor/doctrine/annotations/lib/Doctrine/Common/Annotations/DocParser.php on line 967

    Other Groups in Class A betalactamases

    Sequences

    Download Sequences

    >>MEG_1108|Drugs|betalactams|Class_A_betalactamases|ARL
    ATGAAAAAGTTTTTTACTATCTTTGTCTTACTCTGTGTTTGCTTCGCTTACACAACTGCTACTGCTTCAGCGCAAGGTTT
    AACTAAATTAGAACATAAAAATGATGCCACAGTAGGTGTTTATGGTATTAATACTGCTACCGGAAAAACTTACTCACACA
    ATGCTGACACACGTTTTGCTTATGCATCAACATTTAAAGCCATTACAAGTGGTTTATTATTACAACAAAGTTCTCCTGAA
    GCATTAAACAAGACTGTCACTATAAAAGAGTCAGATATCGTGGCATATTCACCTGTTACTGAACAATATGTTGGAAAAAC
    AATGACCCTACGTCAACTCATTTCCGCTGCTATGTTACAGAGTGACAATACTGCTAGCAATATCATAATGGAGCAACTCG
    GTGGTCTGGATCAAATTTCGTCTCGTTTACAAGCACTCGGAGATACAACAACAAACCCACAACGTTACGAACCTGAGTTA
    AACAACTATGACCCTCAAAGTACAGCAGATACATCAACACCTCGTGCTACTGCCCATAGTTTACAACAGCTGTTAACAAC
    TGATGCAGTTGCACCACAACAACGCAAGTTCTTACAAAATTTAATGTTTAATAATGAAACAGGCGATAGTTTAATCAAAA
    AAGGTGTTCCAGACAGTTATAAAGTAGGCGACAAAAGTGGTCAGGGTACAACTTATGGTACACGTAATGATGTTGCCCTC
    ATATATCCAAAACATCAAACTAAGCCAATTGTTTTAGTCGTCTTTACGAAACATCAGCAACAAGACGCACAACCACAAGA
    TGAGTTAGTTGCACAAGCAGCACGTCATGCAATACATCAGCTCGATTAA

    >>MEG_1109|Drugs|betalactams|Class_A_betalactamases|ARL
    ATGAAAAAGTTTTTTACTATCTTTGTCTTACTCTGTGTTTGCTTCGCTTACACAACTGCTACTGCTTCAGCGCAAGGTTT
    AACTAAATTAGAACATAAAAATGATGCCACAGTAGGTGTTTATGGCATTAATACTGCTACTGGACAAACTTATTCGCACA
    ACGCTGATACCCGTTTTGCTTATGCATCAACTTTTAAAGCCATTACGAGTGGGTTATTATTACAGCAAAATTCTCCTGAA
    GCATTAAACAAAACTGTAACAATAAAAGAATCAGATATCGTGGCATATTCACCTGTTACTGAACAATATGTTGGAAAAAC
    AATGACCCTACGTCAACTCATTTCCGCTGCTATGTTACAGAGTGACAATACTGCTAGCAATATCATAATGGAGCAACTCG
    GTGGTCTGGATCAAATTTCGTCTCGTTTACAAGCACTCGGAGATACAACAACAAACCCACAACGTTACGAACCTGAGTTA
    AACAACTATGACCCTCAAAGTACAGCAGATACATCAACACCTCGTGCTACTGCCCATAGTTTACAACAGCTGTTAACAAC
    TGATGCAGTTGCACCACAACAACGCAAGTTCTTACAAAATTTAATGTTTAATAATGAAACAGGCGATAGTTTAATCAAAA
    AAGGTGTTCCAGACAGTTATAAAGTAGGCGACAAAAGTGGTCAGGGTACAACTTATGGTACACGTAATGATGTTGCCCTC
    ATATATCCAAAACATCAAACTAAGCCAATTGTTTTAGTCGTCTTTACGAAACATCAGCAACAAGACGCACAACCACAAGA
    TGAGTTAGTTGCACAAGCAGCACGTCATGCAATACATCAGCTCGATTAA

    >>MEG_1110|Drugs|betalactams|Class_A_betalactamases|ARL
    ATGAAAAAGTTTTTTACTATCTTTGTCTTACTCTGTGTTTGCTTCGCTTACACAACTGCTACTGCTTCAGCGCAAGGTTT
    AACTAAATTAGAACATAAAAATGATGCCACAGTAGGTGTTTATGGCATTAATACTGCTACTGGACAAACTTATTCGCACA
    ACGCTGATACCCGTTTTGCTTATGCATCAACATTTAAAGCCATTACAAGTGGGTTATTATTACAACAAAGTTCTCCTGAA
    GCATTAAACAAGACTGTCACTATAAAAGAGTCAGATATCGTGGCATATTCACCTGTTACTGAACAATATGTTGGAAAAAC
    AATGACCCTACGTCAACTCATTTCCGCTGCTATGTTACAGAGTGACAATACTGCTAGCAATATCATAATGGAGCAACTCG
    GTGGTCTGGATCAAATTTCGTCTCGTTTACAAGCACTCGGAGATACAACAACAAACCCACAACGTTACGAACCTGAGTTA
    AACAACTATGACCCTCAAAGTACAGCAGATACATCAACACCTCGTGCTACTGCCCATAGTTTACAACAGCTGTTAACAAC
    TGATGCAGTTGCACCACAACAACGCAAGTTCTTACAAAATTTAATGTTTAATAATGAAACAGGCGATAGTTTAATCAAAA
    AAGGTGTTCCAGACAGTTATAAAGTAGGCGACAAAAGTGGTCAGGGTACAACTTATGGTACACGTAATGATGTTGCCCTC
    ATATATCCAAAACATCAAACTAAGCCAATTGTTTTAGTCGTCTTTACGAAACATCAGCAACAAGACGCACAACCACAAGA
    TGAGTTAGTTGCACAAGCAGCACGTCATGCAATACATCAGCTCGATTAA

    >>MEG_1111|Drugs|betalactams|Class_A_betalactamases|ARL
    ATGAAAAAATTTTTTACTATCTTTGTCTTACTCTGTGTTTGCTTTGCTTACACAACTGCTAGTGCTTCAGCGCAAGATTT
    AACAAAATTGGAACATAAGAATGATGCCACAGTTGGTGTTTATGGTATTAATACTGCTACCGGAAAAACTTACTCACACA
    ATGCTGACACACGTTTTGCTTATGCATCAACATTTAAAGCCATTACAAGTGGTTTATTATTACAACAAAGTTCTCCTGAA
    GCATTAAACAAGACTGTCACTATAAAAGAGTCAGATATCGTGGCATATTCACCTGTTACTGAACAATATGTTGGAAAAAC
    AATGACCCTACGTCAACTCATTTCCGCTGCTATGTTACAGAGTGACAATACTGCTAGCAATGTCATAATGGAGCAACTCG
    GTGGTCTGGATCAAATTTCGTCTCGTTTACAAGCACTCGGAGATACAACAACAAACCCACAACGTTACGAACCTGAGTTA
    AACAACTATGACCCTCAAAGTACAGCAGATACATCAACACCTCGTGCAACTGCCCATAGTTTACAACAGCTGTTAACAAC
    TGATGCAGTTGCACCACAACAACGCAAGTTCTTACAAAATTTAATGTTTAATAATGAAACAGGCGATAGTTTAATCAAAA
    AAGGTGTTCCAGACAGTTATAAAGTAGGCGACAAAAGTGGTCAGGGTACAACTTATGGTACACGTAATGATGTTGCCCTC
    ATATATCCAAAACATCAAACTAAGCCAATTGTTTTAGTTGTCTTTACCAAACACAAGCAACAAGACGCAAAGCCACAAGA
    TGCGCTTGTAGCACAAGCAGCACGTCAGGCTATACAGCAGCTCGATTAA

    >>MEG_1112|Drugs|betalactams|Class_A_betalactamases|ARL
    ATGAAAAAGTTTTTTACTATCTTTGTCTTACTCTGTGTTTGCTTCGCTTACACAACTGCTACTGCTTCAGCGCAAGGTTT
    AACTAAATTAGAACATAAAAATGATGCCACAGTAGGTGTTTATGGCATTAATACTGCTACTGGACAAACTTATTCGCACA
    ACGCTGATACCCGTTTTGCTTATGCATCAACTTTTAAAGCCATTACGAGTGGGTTATTATTACAGCAAAATTCTCCTGAA
    GCATTAAACAAAACTGTAACGATAAAAGAATCAGATATCGTGGCGTATTCACCTGTTACCGAACAATATGTCGGAAAAAC
    CATGACCCTACGCCAATTAATTTCCGCTGCTATGTTACAGAGTGACAATACTGCTAGCAATATCATAATGGAACAACTCG
    GTGGTCTAGATCAGCTTTCGTCTCGCTTACAAGCACTCGGTGACACAACAACAAACCCACAACGTTATGAACCCGAATTA
    AATAACTATGATCCACAAAGTACGGCAGATACATCAACACCTCGTGCTACTGCCCATAATTTGCAAAAACTATTAACAAC
    AGATGCCGTTGCACCACAACAGCGTAAGTTTTTACAAAATTTAATGTTCAACAATAAAACAGGTGAGAGTTTAATCAAAA
    AAGGTGTCCCTAACAGTTATAAAGTAGGTGACAAAAGTGGCCAAGGTACAACTTATGGCACGCGTAATGATGTTGCCGTC
    ATCTATCCAAAACATCAAACAAAACCAATTATTTTAGTCGTCTTTACGAAACATCAGCAACAAGACGCACAACCACAAGA
    TGAGTTAGTTGCACAAGCAGCACGTCATGCAATACATCAGCTCGATTAA

    >>MEG_1113|Drugs|betalactams|Class_A_betalactamases|ARL
    ATGAAAAAGTTTTTTACTATCTTTGTCTTACTCTGTGTTTGCTTCGCTTACACAACTGCTACTGCTTCAGCGCAAGGTTT
    AACTAAATTAGAACATAAAAATGATGCCACAGTAGGTGTTTATGGCATTAATACTGCTACTGGACAAACTTATTCGCACA
    ACGCTGATACCCGTTTTGCTTATGCATCAACTTTTAAAGCCATTACGAGTGGGTTATTATTACAGCAAAATTCTCCTGAA
    GCATTAAACAAAACTGTAACAATAAAAGAATCAGATATCGTGGCATATTCACCTGTTACTGAACAATATGTTGGAAAAAC
    AATGACCCTACGTCAACTCATTTCCGCTGCTATGTTACAGAGTGACAATACTGCTAGCAATATCATAATGGAACAACTCG
    GTGGTCTGGATCAGCTTTCGTCTCGCTTACAAGCACTCGGAGATACAACAACAAACCCACAACGTTATGAACCCGAATTA
    AATAACTATGATCCACAAAGTACGGCAGATACATCAACACCTCGTGCTACTGCCCATAATTTGCAAAATCTATTAACAAC
    AGATGCCGTTGCACCACAACAGCGTAAGTTTTTACAAAATTTAATGTTGAACAATAAAACAGGTGAGAGTTTAATCAAAA
    AAGGTGTCCCTAACAGTTATAAAGTAGGTGACAAAAGTGGCCAAGGTACAACTTATGGCACGCGTAATGATGTTGCCGTC
    ATCTATCCAAAACATCAAACAAAACCAATTATTTTAGTCGTCTTTACGAAACATCAGCAACAAGACGCACAACCACAAGA
    TGAGTTAGTTGCACAAGCAGCACGTCATGCAATACATCAGCTCGATTAA