Warning: "continue" targeting switch is equivalent to "break". Did you mean to use "continue 2"? in /home/meglabuser/megares.meglab.org/vendor/doctrine/orm/lib/Doctrine/ORM/UnitOfWork.php on line 2640
MEGARes
MEGAResFrom MEG, the Microbial Ecology Group

Notice: Trying to access array offset on value of type null in /home/meglabuser/megares.meglab.org/vendor/doctrine/annotations/lib/Doctrine/Common/Annotations/DocParser.php on line 967

ZEVB

The ZEVB group of genes confer resistance to Zinc resistance through the mechanism, Zinc resistance protein.

References


    Deprecated: The behavior of unparenthesized expressions containing both '.' and '+'/'-' will change in PHP 8: '+'/'-' will take a higher precedence in /home/meglabuser/megares.meglab.org/src/Sequence.php on line 169

    Notice: Trying to access array offset on value of type null in /home/meglabuser/megares.meglab.org/vendor/doctrine/annotations/lib/Doctrine/Common/Annotations/DocParser.php on line 967

    Other Groups in Zinc resistance protein

    Sequences

    Download Sequences

    >>MEG_7846|Metals|Zinc_resistance|Zinc_resistance_protein|ZEVB
    ATGAAAAAATATAAAACTGGGCTCGTGTTATTAGTGATTGCACTCGCCTTACTTGTCTATTTTTCCCCTTGGTTTTTCTT
    ACATATTGCCAGTTGGCAAAAAGAGTTTAATCAGCTTATTTCGGAAAATTTACATCAAATTCAAAATAATAGCATCAAGG
    CAGGCACCACACTTATTTTCGCCAGCTTTGTTTACGGCGTACTCCATGCCCTCGGGCCAGGACACGGCAAATTTATTATT
    GCCAGCTATCTTTCCACTCATGAAAGCCAATTAAAACAAAGCACTATCTTGAGCTTACTTTCATCCTTAATGCAAGGCAT
    TGTCGCGATTACAGCAACAACATTGCTTGTTGTAGTGCTAAATCTTTCATCACGTTATTTCAAATTAAGTCAGCTTTGGT
    TAGAACGAACTGCCTTGCTATTATTGGTATTTCTCGGCTGTTATTGGATTTGGCAAGGTCTACGTGCCTATCGTAAAAAA
    GCTAAATTAGCCATTAAATCCCTCAATCCCCTCCCTCTACACGAAAAAAGTGCGGTGAAAAATAACCGCACTTTTCAGCC
    AAACACCTGTAGTTGTGGACACCAACATTTGCCAAGCCCGACGCAAACTGCACAAGCAACCAATCTAAAATCGCAATTCC
    TCGTGATTCTAACAATTGGTATGCGCCCTTGTAGCGGTGCGATTTTCGTTTTATTTTTAGCTTATATGCTTGATCTTTAT
    AGCTGGGGAATTTTAGCTGTATTAGCCATGTCTTTCGGCACAGGGCTTATGCTGTCAGCCTTCGCAGGAATTGTACGTTA
    TGCACGAAATACCGCAATCCACTTAGGGCATTGGTATAGTTCAAAAAATACGAAAGGAAAAAGCGAAAGCATCGTGAAAC
    TAATCGCAGGTGGAATAATGCTATTTTTTGCCCTGAGTTTGTTATACGGCACAACCATCTCAACTGGCGGAAGCAAAATC
    CTATTTTGA