Warning: "continue" targeting switch is equivalent to "break". Did you mean to use "continue 2"? in /home/meglabuser/megares.meglab.org/vendor/doctrine/orm/lib/Doctrine/ORM/UnitOfWork.php on line 2640

Deprecated: The behavior of unparenthesized expressions containing both '.' and '+'/'-' will change in PHP 8: '+'/'-' will take a higher precedence in /home/meglabuser/megares.meglab.org/src/Sequence.php on line 169

Warning: Cannot modify header information - headers already sent by (output started at /home/meglabuser/megares.meglab.org/vendor/doctrine/orm/lib/Doctrine/ORM/UnitOfWork.php:2640) in /home/meglabuser/megares.meglab.org/browse/download.php on line 41

Warning: Cannot modify header information - headers already sent by (output started at /home/meglabuser/megares.meglab.org/vendor/doctrine/orm/lib/Doctrine/ORM/UnitOfWork.php:2640) in /home/meglabuser/megares.meglab.org/browse/download.php on line 42

Warning: Cannot modify header information - headers already sent by (output started at /home/meglabuser/megares.meglab.org/vendor/doctrine/orm/lib/Doctrine/ORM/UnitOfWork.php:2640) in /home/meglabuser/megares.meglab.org/browse/download.php on line 43

Warning: Cannot modify header information - headers already sent by (output started at /home/meglabuser/megares.meglab.org/vendor/doctrine/orm/lib/Doctrine/ORM/UnitOfWork.php:2640) in /home/meglabuser/megares.meglab.org/browse/download.php on line 44

Warning: Cannot modify header information - headers already sent by (output started at /home/meglabuser/megares.meglab.org/vendor/doctrine/orm/lib/Doctrine/ORM/UnitOfWork.php:2640) in /home/meglabuser/megares.meglab.org/browse/download.php on line 45

Warning: Cannot modify header information - headers already sent by (output started at /home/meglabuser/megares.meglab.org/vendor/doctrine/orm/lib/Doctrine/ORM/UnitOfWork.php:2640) in /home/meglabuser/megares.meglab.org/browse/download.php on line 46
>>MEG_2482|Drugs|Trimethoprim|Dihydrofolate_reductase|DFRA atgaaactatcactaatggtagctatatcgaagaatggagttatcgggaatggccctgatattccatggagtgccaaaggtgaacagctcctgtttaaagctattacctataaccaatggctgttggttggacgcaagacttttgaatcaatgggagcattacccaaccgaaagtatgcggtcgtaacacgttcaagttttacatctgacaatgagaacgtattgatctttccatcaattaaagatgctttaaccaacctaaagaaaataacggatcatgtcattgtttcaggtggtggggagatatacaaaagcctgatcgatcaagtagatacactacatatatctacaatagacatcgagccggaaggtgatgtttactttcctgaaatccccagcaattttaggccagtttttacccgagacttcgcctctaacataaattatagttacccaatctggcaaaagggttaa >>MEG_2483|Drugs|Trimethoprim|Dihydrofolate_reductase|DFRA atgaactcggaatcagtacgcatttatctcgttgctgcgatgggagccaatcgggttatcggcaatggtcctaatatcccctggaaaattccgggtgagcagaagatttttcgcagactcactgagggaaaagtcgttgtcatggggcgaaagacctttgagtctatcggcaagcctctaccgaaccgtcacacatcggtaatctcacgccaagctaactaccgcgccactggctgcgtagttgtttcaacgctgtcgcacgctatcgctttggcatccgaactcggcaatgaactctacgtcgcgggcggaactgagatatacactctggcactacctcacgcccacggcgtgtttctatctgaggtacatcaaaccttcgagggcgacgccttcttcccaatgctcaacgaaacagaattcgagcttgtctcaaccgaaaccattcaagctgtaattccgtacacccactccgtttatgcgcgtcgaaacggctaa >>MEG_2484|Drugs|Trimethoprim|Dihydrofolate_reductase|DFRA atgaactcggaatcagtacgcatttatctcgttgctgcgatgggagccaatcgggttattggcaatggtcctaatatcccctggaaaattccgggtgagcagaagattcttcgcagactcactgagggaaaagtcgttgtcatggggcgaaagacctttgagtctatcggcaagcctctaccgaaccgtcacacattggtaatctcacgccaagctaactaccgcgccactggctgcgtagttgtttcaacgctgtcgcacgctatcgctttggcatccgaactcggcaatgaactctacgtcgcgggcggagctgagatatacactctggcactacctcacgcccacggcgtgtttctatctgaggtacatcaaaccttcgagggtgacgccttcttcccaatgctcaacgaaacagaattcgagcttgtctcaaccgaaaccattcaagctgtaattccgtacacccactccgtttatgcgcgtcgaaacggctaa >>MEG_2485|Drugs|Trimethoprim|Dihydrofolate_reductase|DFRA atgaactcggaatcagtacgcatttatctcgttgctgcgatgggagccaatcgggttattggcaatggtcctaatatcccctggaaaattccgggtgagcagaagatttttcgcagactcactgagggaaaagtcgttgtcatggggcgaaagacctttgagtctatcggcaagcctctaccgaaccgtcacacattggtaatctcacgccaagctaactaccgcgccactggctgcgtagttgtttcaacgctgtcgcacgctatcgctttggcatccgaactcggcaataaactctacgtcgcgggcggagctgagatatacactctggcactacctcacgcccacggcatgtttctatctgaggtacatcaaaccttcgagggtgacgccttcttcccaatgctcaacgaaacagaattcgagcttgtctcaaccgaaaccattcaagctgtaattccgtacacccactccgtttatgcgcgtcgaaacggctaa >>MEG_2486|Drugs|Trimethoprim|Dihydrofolate_reductase|DFRA atgaactcggaatcagtacgcatttatctcgttgctgcgatgggagccaatcgtgttattggcaatggtcctaatatcccctggaaaattccgggtgagcagaagatttttcgcagactcactgagggaaaagtcgttgtcatggggcgaaagacctttgagtctatcggcaagcctctaccgaaccgtcacacattggtaatctcacgccaagctaactaccgcgccactggccgcgtagttgtttcaacgctgtcgcacgctatcgctttggcatccgaactcggcaatgaactctacgtcgcgggcggagctgagatatacactctggcactaccacacgcccacggcgtgtttctatctgaggtacatcaaaccttcgagggtgacgccttcttcccaatgctcaacgaaacagaattcgagcttgtctcaaccgaaaccattcaagctgtaattccgtacacccactccgtttatgcgcgtcgaaacggctaa >>MEG_2487|Drugs|Trimethoprim|Dihydrofolate_reductase|DFRA atgaactcggaatcagtacgcatttatctcgttgctgcgatgggattaaatcgggttattggcaatggtcctaatatcccctggaaaattccgggtgagcagaagatttttcgcagactcactgagggaaaagtcgttgtcatggggcgaaagacctttgagtctatcggcaagcctctaccgaaccgtcacacattggtaatctcacgccaagctaactaccgcgccactggctgcgtagttgtttcaacgctgtcgcacgctatcgctttggcatccgaactcggcaatgaactctacgtcgcgggcggagctgagatatacactctggcactacctcacgcccacggcgtgtttctatctgaggtacatcaaaccttcgagggtgacgccttcttcccaatgctcaacgaaacagaattcgagcttgtctcaaccgaaaccattcaagctgtaattccgtacacccactccgtttatgcgcgtcgaaacggctaa >>MEG_2488|Drugs|Trimethoprim|Dihydrofolate_reductase|DFRA atgagctcggaatctgtacgcatttatctcgttgctgcgatgggagccaatcgggttattggcaatggtcctaatatcccctggaaaattccgggtgagcagaagatttttcgcagactcactgagggaaaagtcgttgtcatggggcgaaagacctttgagtctatcggcaagcctctaccgaaccgtcacacattggtaatctcacgccaagctaactaccgcgccactggctgcgtatttgtttcaacgctgtcggacgctatcgatttggcatccgaactcggcaatgaactctacgtcgcgggcggagctgagatatacactctggcactacctcacgcccacggcgtgtttctatctgaggtacatcaaaccttcgagggtgacgccttcttcccaatgctcaacaaaacagaattcgagcttgtctcaaccgaaaccattcaagctgtaattccgtacacccactccgtttatgcgcgtcgaaacggctaa >>MEG_2489|Drugs|Trimethoprim|Dihydrofolate_reductase|DFRA atgagtcacccacaacttgagctaatagtcgctgtggattctaagttgggattcgggaaaggcggcaagattccatggaaatgcaaagaagacatggcgcgatttacgcggatttctaaagagatccgcgtgtgcgttatggggaaacacacgtatactgacatgcgtgacatgcagttagaaaaggatggcgccgaggagcgaatcaaggagaaaggaattctccccgaacgcgaatcgttcgtgatctcctcgacgttaaaacaagaagatgtcataggcgctactgtcgttcctgatcttcgtgctgtgatcaacctgtatgagaataccgatcaacgcattgctgtcattggtggggagaagttgtacattcaagctctttcatcagcaacgaaactgcacatgaccataattccaagagagttcgactgtgatcgatttattcctgttgatccgatccagaacaattttcacattgattccagtgccagcgagactgtggaggcaaccgttgatgagactcaagagcgcattcactttgctacttacgtgcgtaacaatcagtaa >>MEG_2490|Drugs|Trimethoprim|Dihydrofolate_reductase|DFRA atgatcacagcatgtgtagcgatcgatagcgatggcggttttggtgcccaggggacgcttccatgggcaataccagaagaatttgctttttaccaagagcatgtcaggggtggtatctgtataattggcggcagatcgtttaatgatctagttcacttatcgctatcaccaaagggtggtttgtataaaaaatgtctactccggaccacgccacatatcgtagtatcatcatcacacgaattggtgtacgatccgtcgataatggcacttatagaggctgacaggagacatcttgatctgtacttcgtgaacaccgtggacgctgctgttaaactcgcaaaagggttaggtggaatgcacgcgaataaagatatccatttcattggcggtaaacgcatatatgatgccggtctcgattattgtgacgaggtatacacctcaatattaccggctgtgtatcttaactgcgacacattctttcctgtagaaaaactgtcgcgcatgtttacaccagaattatacaagacgattcctaaccaagttcatgcggatattcctgtaattaaatggacccgcaagcgcgcataa >>MEG_2491|Drugs|Trimethoprim|Dihydrofolate_reductase|DFRA atgatttcaatcgtcgtagccaaatccgccaatcacgtcatcggggtagacaatcaattaccgtggcgattgccgtccgatctgaagtggtttaaagaaacgaccactggtggggtagttgttatgggacgcaagacatttgaatccatcggtaagccattgccggatcgaatcaatgtgatcatttctaaacaaccagtgccgatcgaatgggcaagtaaggtagtttgggttaactcgatccagcaagcgatggactatgttcgcggtctggatgggatgatcaaaacatttattattggcgggagtgagatttatcgccaatttatctcattggtcgatcaggtgtatcttaccgaagtaggtgccgaaatagaaggcgacgcgacgtttcagccgttagacgaacatgaatggacgctcaaaacttggtgggtggttccagaccaatcatccaaagatcaattccgttaccaacgtaagctctacgtgaggaaggtgttagatgaatga >>MEG_2492|Drugs|Trimethoprim|Dihydrofolate_reductase|DFRA gtgaaactatcactaatggcagcaatttcgaagaatggagttatcggaaatggtccggatattccatggagtgccaaaggggaacaattactcttcaaagcgattacctataatcagtggcttttggtaggccgaaagactttcgagtcaatgggggctttacccaaccgaaaatatgccgttgtaactcgttcaagcttcacttccagtgatgagaatgtattggtatttccatctatcgatgaagcgctaaatcatctgaagacgacaacggatcatgtgattgtgtctggtggtggtgaaatatacaaaagcctgatcgataaagttgatactttacatatttcaacaatcgacattgagccagaaggtgatgtctattttccagaaatccccagtagttttaggccagtttttagccaagacttcgtgtctaacataaattatagttaccaaatctggcaaaagggttaa >>MEG_2493|Drugs|Trimethoprim|Dihydrofolate_reductase|DFRA gtgaaactatcactaatggtagctatatcgaagaatggagttatcgggaatggccctgatattccatggagtgccaaaggtgaacagctcctgcttaaagctattacctataaccagtggctgttggttggacgcaagacttttgaatcaatgggagcattacccaaccgaaagtatgcggtcgtaacacgttcaagttttacatctgacaatgagaacgtattgatctttccatcaattaaagatgctttaaccaacctaaagaaaataacggatcatgtcattgtttcaggtggtggggagatatacaaaagcctgatcgatcaagtagatacactacatatatctacaatagacatcgagccggaaggtgatgtttactttcctgaaatccccagcaattttaggccagtttttacccaagacttcgcctctaacataaattatagttaccaaatctggcaaaagggttaa >>MEG_2494|Drugs|Trimethoprim|Dihydrofolate_reductase|DFRA gtgaaactatcactaatggtagctatatcgaagaatggagttatcgggaatggccctgatattccatggagtgccaaaggtgaacagctcctgtttaaagctattacctataaccaatggctgttggttggacgcaagacttttgaatcaatgggagcattacccaaccgaaagtatacggtcgtaacacgttcaagttttacatctgacaatgagaacgtagtgacctttccatcaattaaagatgctttaaccaacctaaagaaaataacggatcatgtcattgtttcaggtggtggggagatatacaaaagcctgatcgatcaagtagatacactacatatatctacaatagacatcgagccggaaggtgatgtttactttcctgaaatccccagcaattttaggccagtttttacccaagacttcgcctctaacataaattatagttaccaaatctggcaaaagggttaa >>MEG_2495|Drugs|Trimethoprim|Dihydrofolate_reductase|DFRA gtgaaactatcactaatggtagctatatcgaagaatggagttatcgggaatggccctgatattccatggagtgccaaaggtgaacagctcctgtttaaagctattacctataaccaatggctgttggttggacgcaagacttttgaatcaatgggagcattacccaaccgaaagtatgcgatcgtaacacgttcaagttttacatctgacaatgagaacgtattgatctttccatcaattaaagatgctttaaccaacctaaagaaaataacggatcatgtcattgtttcaggtggtggggagatatacaaaagcctgatcgatcaagtagatacactacatatatctacaatagacatcgagccggaaggtgatgtttactttcctgaaatccccagcaattttaggccagtttttacccaagacttcgcctctaacataaattatagttaccaaatctggcaaaagggttaa >>MEG_2496|Drugs|Trimethoprim|Dihydrofolate_reductase|DFRA gtgaaactatcactaatggtagctatatcgaagaatggagttatcgggaatggccctgatattccatggagtgccaaaggtgaacagctcctgtttaaagctattacctataaccaatggctgttggttggacgcaagacttttgaatcaatgggagcattacccaaccgaaagtatgcggtcgcaacacgttcaagttttacatctgacaatgagaacgtattgatctttccatcaattaaagatgctttaaccaacctaaagaaaataacggatcatgtcattgtttcaggtggtggggagatatacaaaagcctgatcgatcaagtagatacactacatatatctacaatagacatcgagccggaaggtgatgtttactttcctgaaatccccagcaattttaggccagtttttacccaagacttcgcctctaacataaattatagttaccaaatctggcaaaagggttaa >>MEG_2497|Drugs|Trimethoprim|Dihydrofolate_reductase|DFRA gtgaaactatcactaatggtagctatatcgaagaatggagttatcgggaatggccctgatattccatggagtgccaaaggtgaacagctcctgtttaaagctattacctataaccaatggctgttggttggacgcaagacttttgaatcaatgggagcattacccaaccgaaagtatgcggtcgtaacacgttcaagctttacatctgacaatgagaacgtattgatctttccatcaattaaagatgctttacccaaccgaaagtatgcggtcgtaacacgttcaagctttacatctgacaatgagaacgtattgatctttccatcaattaaagatgctttaaccaacctaaagaaaataacggatcatgtcattgtttcaggtggtggggagatatacaaaagcctgatcgatcaagtagatacactacatatatctacaatagacatcgagccggaaggtgatgtttactttcctgaaatccccagcaattttaggccagtttttacccaagacttcgcctctaacataaattatagttaccaaatctggcaaaagggttaa >>MEG_2498|Drugs|Trimethoprim|Dihydrofolate_reductase|DFRA gtgaaactatcactaatggtagctatatcgaagaatggagttatcgggaatggccctgatattccatggagtgccaaaggtgaacagctcctgtttaaagctattacctataaccaatggctgttggttggacgcaagacttttgaatcaatgggagcattacccaaccgaaagtatgcggtcgtaacacgttcaagttttacatctgacaatgagaacgtagtgatctttccatcaattaaagatgctttaaccaacctaaagaaaataacggatcatgtcattgtttcaggtggtggggagatatacaaaagcctgatcgatcaagtagatacactacatatatctacaatagacatcgagccggaaggtgatgtttactttcctgaaatccccagcaattttaggccagtttttacccaagacttcgcctctaacataaataatagttaccaattctggcaaaagggttaa >>MEG_2499|Drugs|Trimethoprim|Dihydrofolate_reductase|DFRA gtgaaactatcactaatggtagctatatcgaagaatggagttatcgggaatggccctgatattccatggagtgccaaaggtgaacagctcctgtttaaagctattacctataaccaatggctgttggttggacgcaagacttttgaatcaatgggagcattacccaaccgaaagtatgcggtcgtaacacgttcaagttttacatctgacaatgagaacgtattgatctttccatcaattaaagatgctttaaccaacctaaagaaaataacggatcatgtcattgtttcaggtggtggggagatatacaaaagcctgatcgatcaagtagatacactacatatatctacaatagacatcgagccggaaggtgatgtttactttcctgaaatccccagcaatcttaggccagtccttacccaagacttcgcctctaacataaattatagttaccaaatctggcaaaagggttaa >>MEG_2500|Drugs|Trimethoprim|Dihydrofolate_reductase|DFRA gtgaaactatcactaatggtagctatatcgaagaatggagttatcgggaatggccctgatattccatggagtgccaaaggtgaacagctcctgtttaaagctattacctataaccaatggctgttggttggacgcaagacttttgaatcaatgggagcattacccaaccgaaagtatgcggtcgtaacacgttcaagttttacatctgacaatgagaacgtattgatctttccatcaattaaagatgctttaaccaacctaaagaaaataacggatcatgtcattgtttcaggtggtggggagatatacaaaagcctgatcgatcaagtagatacactacatatatctacaatagacatcgagccggaaggtgatgtttactttcctgaaatccccagcaattttaggccagtttttacccaagacttcgcctctaacataaattatagttaccaaatctggaaaaagggttaa >>MEG_2501|Drugs|Trimethoprim|Dihydrofolate_reductase|DFRA gtgaaactatcactaatggtagctatatcgaagaatggagttatcgggaatggccctgatattccatggagtgccaaaggtgaacagctcctgtttaaagctattacctataaccaatggctgttggttggacgcaagacttttgaatcaatgggagcattacccaaccgaaagtatgcggtcgtaacacgttcaagttttacatctgacaatgagaacgtattgatctttccatcaattaaagatgctttaaccaacctaaagaaaataacggatcatgtcattgtttcaggtggtggggaggtatacaaaagcctgatcgatcaagtagatacactacatatatctacaatagacatcgagccggaaggtgatgtttactttcctgaaatccccagcaattttaggccagtttttacccaagacttcgcctctaacataaattatagttaccaaatctggcaaaagggttaa >>MEG_2502|Drugs|Trimethoprim|Dihydrofolate_reductase|DFRA gtgaaactatcactaatggtagctatatcgaagaatggagttatcgggaatggccctgatattccatggagtgccaaaggtgaacagctcctgtttaaagctattacctataaccaatggctgttggttggacgcaagacttttgaatcaatgggagcattacccaaccgaaagtatgcggtcgtaacacgttcaagttttacatctgacaatgagaacgtattgatctttccatcaattaaagatgctttaaccaacctaaagaaaataacggttcatgtcattgtttcaggtggtggggagatatacaaaagcctgatcgatcaagtagatacactacatatatctacaatagacatcgagccggaaggtgatgtttactttcctgaaatccccagcaattttaggccagtttttacccaagacttcgcctctaacataaattatagttaccaaatctggcaaaagggttaa >>MEG_2503|Drugs|Trimethoprim|Dihydrofolate_reductase|DFRA gtgaaagtatcattaatggctgcaaaagcgaaaaacggagtgattggttgcggtccacacataccctggtccgcgaaaggagagcagctactctttaaagccttgacgtacaaccagtggcttttggtgggccgcaagacgttcgaatctatgggagcactccctaataggaaatacgcggtcgttactcgctcagcctggacggccgataatgacaacgtaatagtattcccgtcgatcgaagaggccatgtacgggctggctgaactcaccgatcacgttatagtgtctggtggcggggagatttacagagaaacattgcccatggcctctacgctccatatatcgacgattgatattgagccggaaggagatgttttctttccgaatattcccaataccttcgaagttgtttttgagcaacgctttagctcaaacattaactattgctatcaaatttggcaaaagggttag >>MEG_2504|Drugs|Trimethoprim|Dihydrofolate_reductase|DFRA gtgaagttatcactaatggctgccaagtcgaagaacggtattatcggtaatggaccagatattccatggagcgccaaaggcgagcaacttctatttaaggcaattacatataatcaatggcttttagttggacgcaaaacttttgagtcaatgggcgctctcccaaatcgaaagtatgcagttgtaactcgctctaatttttctacgaatgatgagggtgtaatggttttctcctcaattcaggatgccttaataaatttagaggaaatcacgggtcatgttatcgtttctggtggtggtgaaatatacaaaagcttgatttccaaagtagatactttgcatatttcaacagtcgacatcgagcgagatggagacatagtttttcctgaaatcccagatacattcaagttggtatttgagcaagatttcgagtctaacattaactattgttatcaaatctggcaaaagagttaa >>MEG_2505|Drugs|Trimethoprim|Dihydrofolate_reductase|DFRA gtgaatgtatcattaatggctgcaaaagcgaaaaaaggagggattggttgcggtccacacataccctggtccgcgaaaggagagcagctactctttaaagccttgacgtacaaccagtggcttttggtgggccgcaagacgttcgaatctatgggagcactccctaataggaaatacgcggtcgttactcgctcagcctggacggccgataatgacaacgtaatattattcccgtcgatcgaagaggccatgtacgggctggctgaactcaccgatcacgttatagtgtctggtggcggggagatttacagagaaacattgcccatggcctctacactccatatatcgacgattgatattgagccggaaggaaatgttttctttccgaatattcccaataccttcgaagttgtttttgagcaacactttaactcaaacattaactattgctatcaaatttggcaaaagggttaa >>MEG_2506|Drugs|Trimethoprim|Dihydrofolate_reductase|DFRA ttgaaaatatcattgatttctgcagtgtcagaaaatggcgtaatcggtagtggtcctgatatcccgtggtcagtaaaaggtgagcaactactctttaaagcgctcacatataatcaatggctccttgtcggaagaaaaacatttgactctatgggtgttcttccaaatcgcaaatatgcagtagtgtcaaagaacggaatttcaagctcaaatgaaaacgtcctagtttttccttcaatagaaaatgctttgaaagagctatcaaaagttacagatcatgtatatgtctctggcgggggtcaaatctataatagccttattgaaaaagcagatataattcatttgtctactgttcacgttgaagtcgaagatgatatcaaattccctataatgcctgagaatttcaatttggtttttgaacagttttttatgtctaatataaattatacataccagatttggaaaaaaggctaa >>MEG_2507|Drugs|Trimethoprim|Dihydrofolate_reductase|DFRA ttgaaaatatcattgatttctgcagtgtcagaaaatggcgtaatcggtagtggtcctgatatcccgtggtcagtaaaaggtgagcaactactctttaaagcgctcacatataatcaatggctccttgtcggaagaaaaacatttgactctatgggtgttcttccaaatcgcaaatatgcagtagtgtcaaagaacggaatttcaagctcaaatgaaaacgtcctagtttttccttcaatagaaaatgctttgaaagagctatcaaaagttacagatcatgtatatgtctctggcgggggtcaaatctataatagccttattgaaaaagcagatataattcatttgtctactgttcccgttgaagtcgaaggagatatcaaattccctataatgcctgaaaatttcaatttggtttttgaacagttttttatgtctaatataaattatacataccagatttggaaaaaaggctaa >>MEG_2508|Drugs|Trimethoprim|Dihydrofolate_reductase|DFRA ttgaaaatatcattgatttctgcagtgtcagaaaatggcgtaatcggtagtggtcctgatatcccgtggtcagtaaaaggtgagcaactactctttaaagcgctcacatataatcaatggctccttgtcggaagaaacacatttgactctatgggtgttcttccaaatcgcaaatatgcagtagtgtcaaagaacggaatttcaagctcaaatgaaaacgtcctagtttttccttcaatagaaaatgctttgaaagagctatcaaaagttacagatcatgtatatgtctctggcgggggtcaaatctataatagccttattgaaaaagcagatataattcatttgtctactgttcacgttgaagtcgaaggtgatatcaaattccctataatgcctgagaatttcaatttggtttttgaacagttttttatgtctaatataaattatacataccagatttggaaaaaaggctaa >>MEG_2509|Drugs|Trimethoprim|Dihydrofolate_reductase|DFRA ttgaaaatatcattgatttctgcagtgtcagaaagtggcgtaatcggtagtggtcctgatatcccgtggtcagtaaaaggtgagcaactactctttaaagcgctcacatataatcaatggctccttgtcggaagaaaaacatttgactctatgggtgttcttccaaatcgcaaatatgcagtagtgtcaaagaacggaatttcaagctcaaatgaaaacgtcctagtttttccttcaatagaaaatgctttgaaagagctatcaaaagttacagatcatgtatatgtctctggcgggggtcaaatctataatagccttattgaaaaagcagatataattcatttgtctactgttcacgttgaagtcgaaggtgatatcaaattccctataatgcctgagaatttcaatttggtttttgaacagttttttatgtctaatataaattatacataccagatttggaaaaaaggctaa >>MEG_2510|Drugs|Trimethoprim|Dihydrofolate_reductase|DFRA ttgaaaatatcatttatttctgcagtgtcagaaaatggcgtaatcggtagtggtcctgatatcccgtggtcagtaaaaggtgagcaactactctttaaagcgctcacatataatcaatggctccttgtcggaagaaaaacatttgactctatgggtgttcttccaaatcgcaaatatgcagtagtgtcaaagaacggaatttcaagctcaaatgaaaacgtcctagtttttccttcaatagaaaatgctttgaaagagctatcaaaagttacagatcatgtatatgtctctggcgggggtcaaatctataatagccttattgaaaaagcagatataattcatttgtctactgttcacgttgaagtcgaaggtgatatcaaattccctataatgcctgagaatttcaatttggtttttgaacagttttttatgtctaatataaattatacataccagatttggaaaaaaggctaa >>MEG_2511|Drugs|Trimethoprim|Dihydrofolate_reductase|DFRA ttgaaaatttcattgatttctgcaacgtcagaaaatggcgtaatcggtaatggccctgatatcccatggtcagcaaaaggtgagcagttactctctaaagcgctcacatataatcagtggctccttgttggaaggaaaacatttgactctatgggtgttcttccaaatcgaaaatatgcagtagtgtcgaggaaaggaatttcaagctcaaatgaaaatgtattagtctttccttcaatagaaatcgcttcgcaagaactatcgaaaattacagatcatttatatgtctctggtggcggtcaaatctacaatagtcttattgaaaaagcagatataattcatttgtctactgttcacgttgaggttgaaggtgatatcaattttcctaaaattccagagaatttcaatttggtttttgagcagttttttttgtctaatataaattacacatatcagatttggaaaaaaggctaa >>MEG_2512|Drugs|Trimethoprim|Dihydrofolate_reductase|DFRA ttgaaaatttcattgatttctgcaacgtcagaaaatggcgtaatcggtaatggccctgatatcccatggtcagcaaaaggtgagcagttactctttaaagcgctcacatataatcagtggctccttgttggaaggaaaacatttgactatatgggtgttcttccaaatcgaaaatatgcagtagtgtcgaggaaaggaatttcaagctcaaatgaaaatgtattagtctttccttcaatagaaatcgctttgcaagaactatcgaaaattacagatcatttatatgtctctggtggcggtcaaatctacaatagtcttattgaaaaagcagatataattcatttgtctactgttcacgttgaggttgaaggtgatatcaattttcctaaaattccagagaatttcaatttggtttttgagcagttttttttgtctaatataaattacacatatcagatttggaaaaaaggctaa >>MEG_2513|Drugs|Trimethoprim|Dihydrofolate_reductase|DFRA ttgaaaatttcattgatttctgcaacgtcagaaaatggcgtaatcggtaatggccctgatatcccatggtcagcaaaaggtgagcagttactctttaaagcgctcacatataatcagtggctccttgttggaaggaaaacctttgactctatgggtgttcttccaaatcgaaaatatgcagtagtgtcgaggaaaggaatttcaagctcaaatgaaaatgtattagtctttccttcaatagaaatcgctttgcaagaactatcgaaaattacagatcatttatatgtctctggtggcggtcaaatctacaatagtcttattgaaaaagcagatataattcatttgtctactgttcacgttgaggttgaaggtgatatcaattttcctaaaattccagagaatttcaatttggtttttgagcagttttttttgtctgatataaattacacatatcagatttggaaaaaaggctaa >>MEG_2514|Drugs|Trimethoprim|Dihydrofolate_reductase|DFRA ttgaaaatttcattgatttctgcaacgtcagaaaatggcgtaatcggtaatggccctgatattccatggagtgccaaaggtgagcagctcctgtttaaagctatcacatataaccaatggctccttgttggaaggaaaacatttgactctatgggtgttcttccaaatcgaaaatatgcagtagtgtcgaggaaaggaatttcaagctcaaatgaaaatgtattagtctttccttcaatagaaatcgctttgcaagaactatcgaaaattacagatcatttatatgtctctggtggcggtcaaatctacaatagtcttattgaaaaagcagatataattcatttgtctactgttcacgttgaggttgaaggtgatatcaattttcctaaaattccagagaatttcaatttggtttttgagcagttttttttgtctaatataaattacacatatcagatttggaaaaaaggctaa >>MEG_2515|Drugs|Trimethoprim|Dihydrofolate_reductase|DFRA ttgaaaatttctttaatcgcagctcagtcagaaaacggtgttattggtaatggcccagatattccatggtcagcaaaaggggagcagttacttttcaaagcgctaacatataatcagtggcttcttgtcggaagaaaaacatttgagtcaatgggtattcttcctaatcgaaagtatgctgttctttcaaaaaatggaatttcacaccttcctgaaaacgtactagttttttcgtctatagaaaatgcattatatgaactggctaaggtaacagaccatttatatatttctggcggtggtcaaatatataatagtcttattgaaagtgctgataccatccacttatctatcatccacaaagaggtagaaggtgaagtaaggtttcccaaaatacctcctaattacaagttggtatttgagcaatattattcttcaaatattaattacacttatcaaatttggcaaaaaggttaa >>MEG_2516|Drugs|Trimethoprim|Dihydrofolate_reductase|DFRA ttgaaagtatcattgatagctgcgaaacgaaaaaacggcgtgattggttgcggtccagacataccgtggtccgcgaaaggggagcagctactttttaaagcattgacctacaatcagtgtcttctggtgggtcgcaagacgtttgaatctatgggcgcactccccaataggaaatacgcggtcgttacccgctcaggttggacatcaaatgatgacaatgtagttgtatttcagtcaatcgaagaggccatggacaggctagctgaattcaccggtcacgttatagtgtctggtggcggagaaatttaccgagaaacattacccatggcctctacgctccacttatcgacgatcgacatcgagccagagggggatgttttcttcccgagtattccaaataccttcgaagttgtttttgagcaacactttacttcaaacattaactattgctatcaaatttggaaaaagggttaa >>MEG_2517|Drugs|Trimethoprim|Dihydrofolate_reductase|DFRA ttgaaagtatcattgatagctgcgaaagcgaaaaacggcgtgattggttgcggtccagacataccctggtccgcgaaaggggagcagctactttttaaagcattgacctacaatcagtggcttctggtgggtcgcaagacgtttgaatctatgggcgcactccccaataggaaatacgcggtcgttacccgctcaggttggacatcaaatgatgacaatgtagttgtatttcagtcaatcgaagaggccatggacaggctagctgaattcaccggtcacgttatagtgtctggtggcggagaaatttaccgagaaacattacccatggcctctacgctccacttatcgacgatcgacatcgagccagagggggatgttttcttcccgagtattccaaataccttcgaagttgtttttgagcaacactttacttcaaacattaactattgctatcaaatttggaaaaagggttaa >>MEG_2518|Drugs|Trimethoprim|Dihydrofolate_reductase|DFRA ttgaaagtatcattgatagctgcgaaagcgaaaaacggcgtgattggttgcggtccagacatatcctggtccgcgaaaggggagcagctactttttaaagcattgacctacaatcagtggcttctggtgggtcgcaagacgtttgaatctatgggcgcactccccaataggaaatacgcggtcgttacccgctcaggttggacatcaaatgatgacaatgtagttgtatttcagtcaatcgaagaggccatggacaggctagctgaattcaccggtcacgttatagtgtctggtggcggagaaatttaccgagaaacattacccatggcctctacgctccacttatcgacgatcgacatcgagccagagggggatgttttcttcccgagtattccaaataccttcgaagttgtttttgagcaacactttacttcaaacattaactattgctatcaaatttggaaaaagggttaa >>MEG_2519|Drugs|Trimethoprim|Dihydrofolate_reductase|DFRA atgaacccggaatcggtccgcatttatctggtcgctgccatgggtgccaatcgggttattggcaatggccctgatatcccttggaatatccctggtgagcaaaagatttttcgcaggctcaccgagggcaaagtggtcgttatgggccgcaagacgtttgagtccataggcaagcccttaccaaaccgtcgcacagtggtgctctcgcgccaagctagttatagcgctgctggttgtgcagttgtttcaacgctgtcgcaggctattgccatcgcagccgaacacggcaaggaactctacgtggccggcggagccgaggtatatgcactggcactacctcgtgccgatggcgtctttctatctgaggtacatcaaaccttcgagggtgacgccttcttcccagtgctcgacgcagcagaattcgacgttgtctcagccgaaaccgttcaagccacaattacgtacacgcactccgtctatgcacgtcgtaacggctaa >>MEG_2520|Drugs|Trimethoprim|Dihydrofolate_reductase|DFRA atgaacccggaattggtccgcatttatctggtcgctgccatgggtgccaatcgggttattggcaatggccccgatattccctggaaaatcccgggtgagcaaaagatctttcgcaggctcaccgagggcaaagtggtcgttatgggccgcaagacgtttgagtccataggcaagcccttaccaaaccgccgcacagtggtgctctcgcgccaagccagttatagcgctgctggttgtgcagttgtttcaacgctgtcgcaggctattgccatcgcagccgaacacggcaaagagctctacgtggccggcggagccgaggtatatgcactggcactacctcgtgccgacggcgtctttctatatgaggtacatcaaaccttcgagggtgacgccttcttccctgtgctcgacgaagcagaattcgaggttgtctcagccgaaaccgttcaagccacaatcacgtacacgcactccgtctatgcacgtcgtaacggctaa >>MEG_2521|Drugs|Trimethoprim|Dihydrofolate_reductase|DFRA atgaaccgggaatcggtccgcatttatctggtcgctgccatgggtgccaatcgggttattggcaatggccccgacatcccctggacaatcccaggtgagcagaagatttttcgcaggctcaccgagggcaaagtggtcgtgatgggtcgtaagacatttgagtccataggaaagcccttaccaagccgccgcacagtggtgctctcccgccaagctggttatagcgctgctggttgtgcagttgtttcaacgctgtcgcaggctattgccatcgcagccgaacacggcaaagaactctacgtagccggcggagccgaggtatatgcactggcactacctcatgccgacggcgtctttctatctgaggtacatcaaaccttcgagggtgacgccttcttccctgtgctcaacgcagcagaattcgaggttgtctcagccgaaaccgttcaagccactatcacgtacacgcactccgtctatgcacgtcgtaacggctaa >>MEG_2522|Drugs|Trimethoprim|Dihydrofolate_reductase|DFRA atgaactcggaatcagtacgcatttatctcattgctgcgatgggagccaatcgggttattggcaatggtcctaatatcccctggaaaattccgggtgagcagaagatttttcgcagactcactgagggaaaagtcgttgtcatggggcgaaagacctttgagtctatcggcaagcctctaccgaaccgtcacacattggtaatctcacgccaagctaactaccgcgccactggctgcgtagttgtttcaacgctgtcgcacgctatcgctttggcatccgaactcggcaatgaactctacgtcgcgggcggagctgagatatacactctggcactacctcacgcccacggcgtgtttctatctgaggtacatcaaaccttcgagggtgacgccttcttcccaatgctcaacgaaacagaattcgagcttgtctcaaccgaaaccattcaagctgtaattccgtacacccactccgtttatgcgcgtcgaaacggctaa >>MEG_2523|Drugs|Trimethoprim|Dihydrofolate_reductase|DFRA atgaactcggaatcagtacgcatttatctcgttgctgcgatgggagccaatcgggttattggcaatggtcctaatatcccctggaaaattccgggtgagcagaagacttttcgcagactcactgagggaaaagtcgttgtcatggggcgaaagacctttgagtctatcggtaagcctctaccgaaccgtcacacattggtaatctcacgccaagctaactaccgcgccactggctgcgtagttgtttcaacgctgtcgcacgctatcgctttggcatccgaactcggcaatgaactctacgtcgcgggcggagctgagatatacactctggcactacctcacgcccacggcgtgtttctatctgaggtacatcaaaccttcgagggtgacgccttcttcccaatgctcaacgaaacagaattcgagcttgtctcaaccgaaaccattcaagctgtaattccgtacacccactccgtttatgcgcgtcgaaacggctaa >>MEG_2524|Drugs|Trimethoprim|Dihydrofolate_reductase|DFRA atgaactcggaatcagtacgcatttatctcgttgctgcgatgggagccaatcgggttattggcaatggtcctaatatcccctggaaaattccgggtgagcagaagatttttcgcagactcactgagggaaaagtcgttgtcatggggcgaaagacctttgagtctatcggcaagcctctaccgaaccgtcacacattggtaatctcacgccaagctaactaccgcgccactggctgcgtagttgtttcaacgctgtcgcacgctatcgctttggcatccgaactcggcaatgaactctacgtcccgggcggagctgagatatacactctggcactacctcacgcccacggcgtgtttctatctgaggtacatcaaaccttcgagggtgacgccttcttcccaatgctcaacgaaacagaattcgagcttgtctcaaccgaaaccattcaagctgtaattccgtacacccactccgtttatgcgcgtcgaaacggctaa >>MEG_2525|Drugs|Trimethoprim|Dihydrofolate_reductase|DFRA atgaactcggaatcagtacgcatttatctcgttgctgcgatgggagccaatcgggttattggcaatggtcctaatatcccctggaaaattccgggtgagcagaagatttttcgcagactcactgagggaaaagtcgttgtcatggggcgaaagacctttgagtctatcggcaagcctctaccgaaccgtcacacattggtaatctcacgccaagctaactaccgcgccactggctgcgtagttgtttcaacgctgtcgcacgctatcgctttggcatccgaactcggcaatgaactctacgtcgcgggcggagctgagatatacactctggcactacctcacgcccacggcgtgtttctatctgaggtacatcaaaccttcgagggtgacgccttcttcccaatgctcaacgaaacagaattcgagcttgcctcaaccgaaaccattcaagctgtaattccgtacacccactccgtttatgcgcgtcgaaacggctaa >>MEG_2526|Drugs|Trimethoprim|Dihydrofolate_reductase|DFRA atgaactcggaatcagtacgcatttatctcgttgctgcgatgggagccaatcgggttattggcaatggtcctaatatcccctggaaaattccgggtgagcagaagatttttcgcagactcactgatggaaaagtcgttgtcatggggcgaaagacctttgagtctatcggcgagcctctaccgaaccgtcacacattggtaatctcacgccaagctaactaccgcgccactggctgcgtagttgtttcaacgctgtcgcacgctatcgctttggcatccgaactcggcaatgaactctacgtcgcgggcggagctgaaatatacactctggcactacctcacgcccacggcgtgtttctatctgaggtacatcaaaccttcgagggtgacgccttcttcccaatgctcaacgaaacaaaattcgagcttgtctcaaccgaaaccattcaagctgtaattccgtacacccactccgtttatgcgcgtcgaaacggctaa >>MEG_2527|Drugs|Trimethoprim|Dihydrofolate_reductase|DFRA gtgaaactatcactaatggtagctatatcgaagaatggagttatcgggaatggccctgatattccatggagtgccaaaggtgaacagctcctgtttaaagctattacctataaccaatggctgttggttggacgcaagacttttgaatcaatgggagcattacccaaccgaaagtatgcggtcgtaacacgttcaagttttacatctgacgatgagaacgtattgatctttccatcaattaaagatgctttaacccacctaaagaaaataacggatcatgtcattgtttcaggtggtggggagatatacaaaagcctgatcgatcaagtagatacactacatatatctacaatagacatcgagccggaaggtgatgtttactttcctgaaatccccagcaattttaggccagtttttacccaagacttcgcctctaacataaattatagttaccaaatctggcaaaagggttaa >>MEG_2528|Drugs|Trimethoprim|Dihydrofolate_reductase|DFRA gtgaaactatcactaatggtagctatatcgaagaatggagttatcgggaatggccctgatattccatggagtgccaaaggtgaacagctcctgtttaaggctattacctataaccaatggctgttggttggacgcaagacttttgaatcaatgggagcattacccaaccgaaagtatgcggtcgtaacacgttcaagttttacatctgacaatgagaacgtagtgatctttccatcaattaaagatgctttaaccaacctaaagaaaataacggatcatgtcattgtttcaggtggtggggagatatacaaaagcctgatcgatcaagtagatacactacatatatctacaatagacatcgagccggaaggtgatgtttactttcctgaaatccccagcaattttaggccagtttttacccaagacttcgcctctaacataaattatagttaccaaatctggcaaaagggttaa >>MEG_2529|Drugs|Trimethoprim|Dihydrofolate_reductase|DFRA gtgaaactatcactaatggtagctatatcgaagaatggagttatcgggaatggccctgatattccatggagtgccaaaggtgaacggctcctgtttaaagctattacctataaccaatggctgttggttggacgcaagacttttgaatcaatgggagcattacccaaccgaaagtatgcggtcgtaacacgttcaagttttacatctgacaatgagaacgtattgatctttccatcaattaaagatgctttaaccaacctaaagaaaataacggatcatgtcattgtttcaggtggtggggagatatacaaaagcctgatcgatcaagtagatacactacatatatctacaatagacatcgagccggaaggtgatgtttactttcctgaaatccccagcaattttaggccagtttttacccaagacttcgcctctaacataaattatagttaccaaatctggcaaaagggttaa >>MEG_2530|Drugs|Trimethoprim|Dihydrofolate_reductase|DFRA gtgaaagtatcattaacggctgcaaaagcgaaaaacggagtgattggttgcggtccacacataccctggtccgcgaaaggagagcagctactctttaaagccttgacgtacaaccagtggcttttggtgggccgcaagacgttcgaatctatgggagcactccctaataggaaatacgcggtcgttactcgctcagcctggacggccgataatgacaacgtaatagtattcccgtcgatcgaagaggccatgtacgggctggctgaactcaccgatcacgttatagtgtctggtggcggggagatttacagagaaacattgcccatggcctctacgctccatatatcgacgattgatattgagccggaaggagatgttttctttccgaatattcccaataccttcgaagttgtttttgagcaacactttagctcaaacattaactattgctatcaaatttggcaaaagggttaa >>MEG_2531|Drugs|Trimethoprim|Dihydrofolate_reductase|DFRA gtgaagttatcactaatggctgccaagtcgaagaacggtattatcggtaatggaccagatattccatggagcgccaaaggcgagcaacttctatttaaggcaattacatataatcaatggcttttagttggacgcaaaacttttgagtcaatgggcgctctcccaaatcgaaagtatgcagttgtaactcgctctaatttttctacgaatgatgagggtgtaatggttttctcctcaattcaggatgccttaataaatttagaggaaatcacggatcatgttatcatttctggtggtggtgaaatatacaaaagcttgatttccaaagtagatactttgcatattgcaacagtcgacatcgagcgagatggagacatagtttttcctgaaatcccagatacattcaagttggtatttgagcaagatttcgagtctaacattaactattgttatcaaatctggcaaaagagttaa >>MEG_2532|Drugs|Trimethoprim|Dihydrofolate_reductase|DFRA ttgaaaatatcattaatttctgcagtgtcagaagatggcgtaatcggtagtggtcctgatatcccgtggtcagtaaaaggtgagcaactactctttaaagcgctcacatataatcaatggctccttgtcggaagaaaaacatttgactctatgggtgttcttccaaatcgcaaatatgcagtagtgtcaaagaacggaatttcaagctcaaatgaaaacgtcctagtttttccttcaatagaaaatgctttgaaagagctatcaaaagttacagatcatgtatatgtctctggcgggggtcaaatctataatagccttattgaaaaagcagatataattcatttgtctactgttcacgttgaagtcgaaggtgatatcaaattccctataatgcctgagaatttcaatttggtttttgaacagttttttatgtctaatataaattatacataccagatttggaaaaaaggctaa >>MEG_2533|Drugs|Trimethoprim|Dihydrofolate_reductase|DFRA ttgaaaatatcattgatttctgcagtgccagaaaatggcgtaatcggtagtggtcctgatatcccgtggtcagtaaaaggtgagcaactactctttaaagcgctcacatataatcaatggctccttgtcggaagaaaaacatttgactctatgggtgttcttccaaatcgcaaatatgcagtagtgtcaaagaacggaatttcaagctcaaatgaaaacgtcctagtttttccttcaatagaaaatgctttgaaagagctatcaaaagttacagatcatgtatatgtctctggcgggggtcaaatctataatagccttattgaaaaagcagatataattcatttgtctactgttcacgttgaagtcgaaggtgatatcaaattccctataatgcctgagaatttcaatttggtttttgaacagttttttatgtctaatataaattatacataccagatttggaaaaaaggctaa >>MEG_2534|Drugs|Trimethoprim|Dihydrofolate_reductase|DFRA ttgaaaatatcattgatttctgcagtgtcagaaaatggcgtaatcggtagtggtcctgatatcccgcggtcagtaaaaggtgagcaactactctttaaagcgctcacatataatcaatggctccttgtcggaagaaaaacatttgactctatgggtgttcttccaaatcgcaaatatgcagtagtgtcaaagaacggaatttcaagctcaaatgaaaacgtcctagcttttccttcaatagaaaatgctttgaaagagctatcaaaagttacagatcatgtatatgtctctggcgggggtcaaatctataatagccttattgaaaaagcagatataattcatttgtctactgttcacgttgaagtcgaaggtgatatcaaattccctataatgcctgagaatttcaatttggtttttgaacagttttttatgtctaatataaattatacataccagatttggaaaaaaggctaa >>MEG_2535|Drugs|Trimethoprim|Dihydrofolate_reductase|DFRA ttgaaaatatcattgatttctgcagtgtcagaaaatggcgtaatcggtagtggtcctgatatcccgtggtcagtaaaaggtgagcaactactctttaaagcgctcacatataatcaatggctccttgtcggaagaaaaacatttgactctatgggcgttcttccaaatcgcaaatatgcagtagtgtcaaagaacggaatttcaagctcaaatgaaaacgtcctagtttttccttcaatagaaaatgctttgaaagagctatcaaaagttacagatcatgtatatgtctctggcgggggtcaaatctataatagccttattgaaaaagcagatataattcatttgtctactgttcacgttgaagtcgaaggtgatatcaaattccctataatgcctgagaatttcaatttggtttttgaacagttttttatgtctaatataaattatacataccagatttggaaaaaaggctaa >>MEG_2536|Drugs|Trimethoprim|Dihydrofolate_reductase|DFRA ttgaaaatatcattgatttctgcagtgtcagaaaatggcgtaatcggtagtggtcctgatatcccgtggtcagtaaaaggtgagcaactactctttaaagcgctcacatataatcaatggctccttgtcggaagaaaaacatttgactctatgggtgttcttccaaatcgcaaatatgcagtagtgtcaaagaacggaatttcaagctcaaatgaaaacgtccgagtttttccttcaatagaaaatgctttgaaagagctatcaaaagttacagatcatgtatatgtctctggcgggggtcaaatctataatagccttattgaaaaagcagatataattcatttgtctactgttcacgttgaagtcgaaggtgatatcaaattccctataatgcctgagaatttcaatttggtttttgaacagttttttatgtctaatataaattatacataccagatttggaaaaaaggctaa >>MEG_2537|Drugs|Trimethoprim|Dihydrofolate_reductase|DFRA ttgaaaatatcattgatttctgcagtgtcagaaaatggcgtaatcggtagtggtcctgatatcccgtggtcagtaaaaggtgagcaactactctttaaagcgctcacatataatcaatggctccttgtcggaagaaaaacatttgactctatgggtgttcttccaaatcgcaaatatgcagtagtgtcaaagaacggaatttcaagctcaaatgaaaacgtcctagtttttccttcaatagaaaatgctttgaaagagctaccaaaagttacagatcatgtatatgtctctggcgggggtcaaatctataatagccttattgaaaaagcagatataattcatttgtctactgttcacgttgaagtcgaaggtgatatcaaattccctataatgcctgagaatttcaatttggtttttgaacagttttttatgtctaatataaattatacataccagatttggaaaaaaggctaa >>MEG_2538|Drugs|Trimethoprim|Dihydrofolate_reductase|DFRA ttgaaaatatcattgatttctgcagtgtcagaaaatggcgtaatcggtagtggtcctgatatcccgtggtcagtaaaaggtgagcaactactctttaaagcgctcacatataatcaatggctccttgtcggaagaaaaacatttgactctatgggtgttcttccaaatcgcaaatatgcagtagtgtcaaagaacggaatttcaagctcaaatgaaaacgtcctagtttttccttcaatagaaaatgctttgaaagagctatcaaaagttacagatcatgtatatgtctctgacgggggtcaaatctataatagccttattgaaaaagcagatataattcatttgtctactgttcacgttgaagtcgaaggtgatatcaaattccctataatgcctgagaatttcaatttggtttttgaacagttttttatgtctaatataaattatacataccagatttggaaaaaaggctaa >>MEG_2539|Drugs|Trimethoprim|Dihydrofolate_reductase|DFRA ttgaaaatatcattgatttctgcagtgtcagaaaatggcgtaatcggtagtggtcctgatatcccgtggtcagtaaaaggtgagcaactactctttaaagcgctcacatataatcaatggctccttgtcggaagaaaaacatttgactctatgggtgttcttccaaatcgcaaatatgcagtagtgtcaaagaacggaatttcaagctcaaatgaaaacgtcctagtttttccttcaatagaaaatgctttgaaagagctatcaaaagttacagatcatgtatatgtctctggcgggggtcaaatctataataaccttattgaaaaagcaataacaattcatttgtctactgatcacgttgaagtccaaggtgctatcaaattccctataatgcctgagaatttcaatttggtttttgaacagttttttatgtctaatataaattatacataccagatttggaaaaaaggctaa >>MEG_2540|Drugs|Trimethoprim|Dihydrofolate_reductase|DFRA ttgaaagtatcattgatggctgcaagagcgaaaaatggcgtaatcggttgcggtcctgacattccttggtctgccaaaggggaacagcttcttttcaaagcactgacctataaccaatggcttttggtagggcgcaaaacatttgagtctatggggccgctgcccaataggaaatacgcggttgttacccgctcaaactggacagcggctaatgaaaacgtagtggttttcccgtcgattgacgaagcgatgggtagattaggcgagatcactgaccatgtcatcgtcgccggtggtggagaaatctaccatgaaacgatacccatggcctctactctgcatgtgtcgacaatcgacgttgagccagagggagacgttttctttccgaacattcctgggaagtttgatgtcgtttttgagcaacaatttacatcaaacattaactattgctatcaaatctggcaaaagggttaa >>MEG_2541|Drugs|Trimethoprim|Dihydrofolate_reductase|DFRA ATGAGTCACCCACAACTTGAGCTAATAGTCGCTGTGGATTCTAAGTTGGGATTCGGGAAAGGCGGCAAGATTCCATGGAAATGCAAAGAAGACATGGCGCGATTTACGCGGATTTCTAAAGAGATCCGCGTGTGCGTTATAGGGAAACACACGTATACTGACATGCGTGACATGCAGTTAGAAAAGGATGGCGCCGAGGAGCGAATCAAGGAGAAAGGAATTCTCCCCGAACGCGAATCGTTCGTGATCTCCTCGACGTTAAAACAAGAAGATGTCATAGGCGCTACTGTCGTTCCTGATCTTCGTGCTGTGATCAACCTGTATGAGAATACCGATCAACGCATTGCTGTCATTGGTGGGGAGAAGTTGTACATTCAAGCTCTTTCATCAGCAACGAAACTGCACATGACCATAATTCCAAGAGAGTTCGACTGTGATCGATTTATTCCTGTTGATCCGATCCAGAACAATTTTCACATTGATTCCAGTGCCAGCGAGACTGTGGAGGCAACCGTTGATGAGACTCAAGAGCGCATTCACTTTGCTACTTACGTGCGTAACAATCAGTAA >>MEG_2542|Drugs|Trimethoprim|Dihydrofolate_reductase|DFRA ATGGCTGATGAAGAATACGACCCGCTACTCGATGACGACATGGAAGATGCCAAAGTCGCCGTCATTGCTGCCCGTGCGCAAAACGGTTGCATTGGTCGCCACGGCAAGCTGCCGTGGAAGCTGCCCGGTGACCTGAAATACTTCCGTGAGCGCACCTGGGGCAAGCCCATCATCATGGGGCGCAAAACCTGGGAATCACTCAATGGTGCCTTGCCGGGGCGCACCAACATCGTGGTAACGCGTCAACAAGGTTATGAAGCCGAAGGTGCTCGCGTGGTCGATAGCATCGAAGAAGCCATTAGCTTGGCACAGTCTATCGCCTTAATCGAAGCCGTTGATGAAATCATGGTGCTGGGCGGCGGCGAAATCTATACCCAAGCCTTACCGCAAGCCGACATTCTCTATCTCACCGAAGTACACGCCTCGGTCGACGGCGATGCCTTCTTCCCCGACGTGGACCTCAGCCAATATCAAGAAACCCAACGCCAGGACTTCGAGCCATCGGGCGGCAACCCTTACCCGTTTAGCTTTGTGGTCTATCAGCGGACGTAG >>MEG_2543|Drugs|Trimethoprim|Dihydrofolate_reductase|DFRA ATGAACCCGGAATCGGTCCGCATTTATCTGGTCGCTGCCATGGGTGCCAATCGGGTTATTGGCAATGGTCCCGATATCCCCTGGAAAATCCCAGGTGAGCAGAAGATTTTTCGCAGGCTCACCGAGAGCAAAGTGGTCGTTATGGGCCGCAAGACATTTGAGTCCATAGGCAAGCCCTTACCAAACCGCCACACAGTGGTGCTCTCGCGCCAAGCTCGTTATAGCGCTCCTGGTTGTGCAGTTGTTTCAACGCTGTCACAGGCTATCGCCATCGCAGCCGAACACGGCAAAGAACTCTACGTAGCCGGCGGAGCCGAGGTATATGCGCTGGCGCTACCGCATGCCAACGGCGTCTTTCTATCTGAGGTACATCAAACCTTTGAGGGTGACGCCTTCTTCCCAGTGCTTAACGCAGCAGAATTCGAGGTTGTCTCATCCGAAACCATTCAAGGCACAATCACGTACACGCACTCCGTCTATGCGCGTCGTAACGGCTAA >>MEG_2544|Drugs|Trimethoprim|Dihydrofolate_reductase|DFRA CTATCGCTCATACGTCGTCGCGATAGTGAAACTGCCGTTTTCGATAATGTGGCCTCTGGACGTTACGCGCCATTGTCGGCCTTCAGTGTCGTATCCGGGACTTTCCCAGAATACGTCTACGTGAGTATCCGCTGCAGGATACGCCCTCAACACCTTCGTTTCAAAAACCTTCGTAATGACGTCTTTGTGCAGATTATAGATTTCAGCACCGCCCGCCACGATGATCTCAGTAACGCCCAGGTGTTCGGCCACTTCAAACAGATGGCAGCTATTCCCCCACGCTACAAAGGTGCCGTCTCCACGTTCGGTTATATCCGCTTTATCGTAAGGCTCGCGTGTGAGCACGATGACGTTGCGTCCGGGCAGGCCATTGGGGATGCTCTCAAAGGTCTTTCTGCCCATGACGAGTGTCTTACCCATAGTGATCGCTTTGAAGCGTTTGAGGTCTTCTTTCAACCGAACTCCTTCGACATGCCAAGGCAAGTCGCCGTCCTGACCAATCTCACCGTTTACACCACGCGCTACAATCATTGAAAATTGAATTTCTTTATTCAT >>MEG_2545|Drugs|Trimethoprim|Dihydrofolate_reductase|DFRA ATGACTAAACAAGCAATATTTGCCGTAGCCGAGAACCTAGCCTTCGGGCTAGGTGGGGGTCTCCCTTGGGATACGCTGAAAGACGACTTACAATTCTTTAAGAGGCTAACTGAAGGGACTGACTTAGTAATGGGAGCCTCCACGTACAGAACGCTGCCATTGTTACCAACCAATAACAGACAGTTTATTGTGGTAAGCAATACTGAGGAGCCTAGCCTTAATGTTCATGTGGTATCTCCAGAACACTTCAAGGCTTTCCTTAGCAAAACTTCCAGAAACCTTACTATTATCGGGGGCAGCTCGTTACTAACGGTAGATATATTATCAAAAATGGATAAGATAATTATGACTACGGTGTATGGAAGTTTTGATGCAGATGTATACTTACCTACTGAAGTAGTAAGTTATGTTACTGGCAAAGCTTCAAACGCCACATTATTTAATAACTCGGACGCAAAGATGGCAGTTTATTATGGATAA >>MEG_2546|Drugs|Trimethoprim|Dihydrofolate_reductase|DFRA GTGAAAGTATCATTAATGGCTGCAAAAGCGAAAAACGGAGTGATTGGTTGCGGTCCACACATACCCTGGTCCGCGAAAGGAGAGCAGCTACTCTTTAAAGCCTTGACGTACAACCAGTGGCTTTTGGTGGGCCGCAAGACGTTCGAATCTATGGGAGCACTCCCTAATAGGAAATACGCGGTCGTTACTCGCTCAGCCTGGACGGCCGATAATGACAACGTAATAGTATTCCCGTCGATCGAAGAGGCCATGTACGGGCTGGCTGAACTCACCGATCACGTTATAGTGTCTGGTGGCGGGGAGATTTACAGAGAAACATTGCCCATGGCCTCTACGCTCCATATATCGACGATTGATATTGAGCCGGAAGGAGATGTTTTCTTTCCGAATATTCCCAATACCTTCGAAGTTGTTTTTGAGCAACACTTTAGCTCAAACATTAACTATTGCTATCAAATTTGGCAAAAGGGTTAA >>MEG_2547|Drugs|Trimethoprim|Dihydrofolate_reductase|DFRA TTGAAAATATCATTGATTTCTGCAGTGTCAGAAAATGGCGTAATCGGTAGTGGTCCTGATATCCCGTGGTCAGTAAAAGGTGAGCAACTACTCTTTAAAGCGCTCACATATAATCAATGGCTCCTTGTCGGAAGAAAAACATTTGACTCTATGGGTGTTCTTCCAAATCGCAAATATGCAGTAGTGTCAAAGAACGGAATTTCAAGCTCAAATGAAAACGTCCTAGTTTTTCCTTCAATAGAAAATGCTTTGAAAGAGCTATCAAAAGTTACAGATCATGTATATGTCTCTGGCGGGGGTCAAATCTATAATAGCCTTATTGAAAAAGCAGATATAATTCATTTGTCTACTGTTCACGTTGAAGTCGAAGGTGATATCAAATTCCCTATAATGCCTGAGAATTTCAATTTGGTTTTTGAACAGTTTTTTATGTCTAATATAAATTATACATACCAGATTTGGAAAAAAGGCTAA >>MEG_2548|Drugs|Trimethoprim|Dihydrofolate_reductase|DFRA TTGAAAATTTCATTGATTTCTGCAACGTCAGAAAATGGCGTAATCGGTAATGGCCCTGATATCCCATGGTCAGCAAAAGGTGAGCAGTTACTCTTTAAAGCGCTCACATATAATCAGTGGCTCCTTGTTGGAAGGAAAACATTTGACTCTATGGGTGTTCTTCCAAATCGAAAATATGCAGTAGTGTCGAGGAAAGGAATTTCAAGCTCAAATGAAAATGTATTAGTCTTTCCTTCAATAGAAATCGCTTTGCAAGAACTATCGAAAATTACAGATCATTTATATGTCTCTGGTGGCGGTCAAATCTACAATAGTCTTATTGAAAAAGCAGATATAATTCATTTGTCTACTGTTCACGTTGAGGTTGAAGGTGATATCAATTTTCCTAAAATTCCAGAGAATTTCAATTTGGTTTTTGAGCAGTTTTTTTTGTCTAATATAAATTACACATATCAGATTTGGAAAAAAGGCTAA >>MEG_2549|Drugs|Trimethoprim|Dihydrofolate_reductase|DFRA ATGAAAATATCCATTATGGCAGCTGTTTCCGAGAATGGAGTAATTGGCTCTGGATTGGATATACCTTGGCATGTATATGGTGAGCAGCTCCTGTTCAAAGCTATGACTTACAATCATTGGCTTTTAGTCGGTCGTAAAACTTTCGACTCAATGGGTAAACTTCCGAATAGGAAATATGCTGTGGTTACTCGTACTGAAATGGTCTCGAATGATCCTGATGTTGTTTATTTCACAAGCGTTGAATCGGCATTAGCTTACTTAGACCACACGACAACACATGTCTTTGTTTCTGGTGGTGGTGAAATTTACAAAGCATTAATCGAACAAGCAGATGTTATCCATCTTTCAGTGATTCATAAGCACATCTCTGGCGACGTGTTTTTCCCTTCAGTTCCACAGAGTTTCAAGCAAACATTTGAGCAAAGTTTCAGTTCAAATATTGATTACACGTACCAAATTTGGACAAAGGGCTAA >>MEG_2550|Drugs|Trimethoprim|Dihydrofolate_reductase|DFRA GTGAAAATATCACTAATGGCTGCAAAAGCAAGAAATGGGGTTATTGGCTGCGGCTCTGATATCCCTTGGAACGCTAAAGGCGAGCAGCTGCTTTTTAAAGCAATAACTTACAATCAGTGGCTTTTAGTCGGCCGCAAAACATTTGAGGCAATGGGGGCTCTCCCAAATAGAAAGTATGCAGTTGTCAGCCGCTCAGGATCGGTAGCTACTAACGATGATATGGTTGTGTTTCCATCTATAGAAGCAGCAATGGGTAAGCTAAAGACTCTTACGAACCATGTTGTTGTTTCTGGTGGTGGAGAGATCTATAAGAGTCTGATCGCCCATGCCGACACGCTACATATTTCGACAATAGATTCCGAGCCAGAGGGCAATGTTTTCTTTCCGGAAATCCCCAAAGATTTCAATGTGGTGTTCGAGCAGGAATTTCATTCAAATATAAATTATCGATATCAAATCTGGCAAAGGGGTTAA >>MEG_2551|Drugs|Trimethoprim|Dihydrofolate_reductase|DFRA ATGAACTCGGAATCAGTACGCATTTATCTCGTTGCTGCGATGGGAGCCAATCGGGTTATTGGCAATGGTCCTAATATCCCCTGGAAAATTCCGGGTGAGCAGAAGATTTTTCGCAGACTCACTGAGGGAAAAGTCGTTGTCATGGGGCGAAAGACCTTTGAGTCTATCGGCAAGCCTCTACCGAACCGTCACACATTGGTAATCTCACGCCAAGCTAACTACCGCGCCACTGGCTGCGTAGTTGTTTCAACGCTGTCGCACGCTATCGCTTTGGCATCCGAACTCGGCAATGAACTCTACGTCGCGGGCGGAGCTGAGATATACACTCTGGCACTACCTCACGCCCACGGCGTGTTTCTATCTGAGGTACATCAAACCTTCGAGGGTGACGCCTTCTTCCCAATGCTCAACGAAACAGAATTCGAGCTTGTCTCAACCGAAACCATTCAAGCTGTAATTCCGTACACCCACTCCGTTTATGCGCGTCGAAACGGCTAA >>MEG_2552|Drugs|Trimethoprim|Dihydrofolate_reductase|DFRA ATGAATATATCACTTATCTTTGCCAATGAATTAATTACCAGAGCATTCGGTAATCAAGGCAAATTACCTTGGCAATTCATTAAAGAAGATATGCAGTTCTTCCAGAAGACTACAGAAAATTCTGTAGTCGTTATGGGATTAAATACATGGAGATCTCTACCTAAGATGAAGAAGCTTGGTAGAGACTTCATTGTCATATCTTCAACTATCACAGAGCACGAAGTGCTCAACAATAATATCCAAATATTCAAATCATTTGAGAGCTTCTTAGAAGCATTCAGAGACACAACCAAACCAATCAATGTCATTGGTGGTGTTGGTTTATTATCTGAAGCGATAGAACATGCTAGCACTGTTTACATGAGTTCTATTCATATGGTTAAACCTGTTCATGCTGATGTGTATGTACCGGTAGAACTAATGAATAAACTCTATAGTGATTTCAAATATCCAGAAAATATTCTATGGGTAGGTGATCCAATAGATTCTGTGTATAGCTTGTCTATTGATAAGTTTGTTAGACCAGCTTCGCTGGTTGGGGTGCCAAATGATATTAATACGTGA >>MEG_2553|Drugs|Trimethoprim|Dihydrofolate_reductase|DFRA ATGATCGAGCTTCATGCCATTTTAGCTGCCACCGCCAATGGTTGCATTGGGAAGGACAACGCACTTCCCTGGCCACCACTAAAAGGCGATCTGGCCAGATTCAAAAAATTGACCATGGGGAAGGTGGTCATTATGGGGCGCAAGACCTATGAGAGCTTGCCCGTCAAATTAGAAGGTCGCACCTGCATCGTTATGACGCGCCAAGCGCTGGAGCTTCCGGGTGTTCGTGACGCTAACGGCGCTATCTTCGTGAACAACGTCAGCGACGCCATGCGGTTCGCTCAAGAAGAGAGCGTGGGCGATGTGGCCTACGTCATTGGTGGCGCTGAGATATTCAAGCGACTTGCCTTGATGATCACGCAGATTGAATTGACCTTTGTTAAGCGACTGTACGAAGGCGACACCTACGTTGATCTGGCCGAAATGGTCAAAGACTACGAGCAGAATGGCATGGAAGAACATGACCTTCACACTTACTTCACTTACCGTAAAAAGGAGCTTACAGAATGA >>MEG_2554|Drugs|Trimethoprim|Dihydrofolate_reductase|DFRA GTGAAAATATCACTAATGGCTGCAAAAGCAAGAAATGGGGTTATTGGCTGCGGCTCGGATATCCCGTGGAACGCTAAAGGTGAGCAGCTGCTTTTTAAAGCAATAACTTACAATCAATGGCTCTTAGTCGGCCGTAAAACATTTGAGGCAATGGGGGCTCTCCCAAATAGAAAGTATGCAGTTGTCAGCCGCTCAGGATCGGTAGCTACTAACGATGATGTGGTTGTGTTTCCATCTATAGAAGCAGCAATGAGGGAGCTAAAGACTCTTACGAACCATGTTGTTGTTTCTGGTGGTGGAGAGATCTACAAGAGTCTGATCGCCCATGCCGACACGCTACATATCTCGACAATAGATTCCGAGCCAGAGGGCAATGTTTTCTTTCCGGAAATCCCCAAAGAGTTCAATGTGGTGTTCGAGCAGGAATTTCATTCAAATATAAATTATCGCTATCAAATCTGGCAAAGGGGTTAA >>MEG_2555|Drugs|Trimethoprim|Dihydrofolate_reductase|DFRA ATGGCTGCAAGAGCGAAAAATGGCGTAATCGGTTGCGGTCCTAACATTCCTTGGTCTGCCAAAGGGGAACAGCTTCTTTTCAAAGCACTGACCTATAACCAATGGCTTTTGGTAGGGCGCAAAACATTTGAGTCTATGGGGCCGCTGCCCAATAGGAAATACGCGGTTGTTACCCGCTCAAACTGGACAGCGGCTAATGAAAACGTAGTGGTTTTCCCGTCGATTGACGAAGCGATGGGTAGATTAGGCGAGATCACTGACCATGTCATCGTCGCCGGTGGTGGAGAAATCTACCATGAAACGATACCCATGGCCTCTACTCTGCATGTGTCGACAATCGACGTTGAGCCAGAGGGAGACGTTTTCTTTCCGAACATTCCTGGGAAGTTTGATGTCGTTTTTGAGCAACAATTTACATCAAACATTAACTATTGCTATCAAATCTGGCAAAAGGGTTAA >>MEG_2556|Drugs|Trimethoprim|Dihydrofolate_reductase|DFRA ATGGCTTCTCTAAACATGATTGTCGCTGTCAATAAGACAGGAGGTATCGGATTTGAAAATCAGATTCCGTGGCATGAACCAGAAGATTTAAAACACTTCAAAGCTGTTACAATGAACTCAGTTTTGATTATGGGTAGAAAAACTTTTGCCTCACTGCCTAAAGTGCTGCCCGGACGACTTCATGTGGTAGTCAGTAAAACAGTACCACCCACCCAGAACACTGATCAAGTTGTGTATGTAAGTACATACCAGATCGCAGTAAGAACTGCAAGCTTGTTGGTTGACAAACCAGAGTATTCTCAAATTTTTGTAATTGGTGGGAAGAGTGCGTACGAGAACTTAGCTGCCTACGTGGACAAACTCTACTTAACTAGAGTACAGCTCAACACACAACAAGACACTGAACTGGATTTATCCCTATTCAAGTCATGGAAACTCGTATCTGAGGTCCCGACCATTACTGAAAACAAAACAAAACTTATTTTCCAAATTTGGATTAACCCTAACCCTATTAGTGAGGAACCCACATGTTAG >>MEG_2557|Drugs|Trimethoprim|Dihydrofolate_reductase|DFRB atgaatgaaggaaaaaatgaggtcagtacttcagctgctggccggttcgcattcccatcaaacgccacgtttgccttgggggatcgcgtacgcaagaagtctggcgctgcttggcaggggcgcattgtcgggtggtactgcacaacacttacccctgaaggctacgccgtcgagtccgaatctcacccagactcagtccagatttatcccatgactgcgcttgaacgggtggcctga >>MEG_2558|Drugs|Trimethoprim|Dihydrofolate_reductase|DFRB atggaacgaagtagcaatgaagtcagtaatccagttgctggcaattttgtattcccatcgaacgccacgtttggtataggagatcgcgtgcgcaagaaatccggcgccgcctggcaaggtcagattgtcggctggtactgcacaaatttgacccccgaaggctacgccgtcgagtctgaggctcacccaggctcagtacagatttatcctgttgcggcgcttgagcgcatcaactga >>MEG_2559|Drugs|Trimethoprim|Dihydrofolate_reductase|DFRB atgaatcaaagtagcaattgcatcagcactccagttgttggacagtttgcgctgccatttcaacccacgttcggcctgggagatcgcgtacgcaagaagtctggcgccgcttggcaaggtaaagttgtcggctggtactgcacaaaattaacccctgaaggctacgcggtcgagtccgaagctcatccaggctcagtgcagatttatcctgtggctgcgcttgaacgcgtggcctaa >>MEG_2560|Drugs|Trimethoprim|Dihydrofolate_reductase|DFRB atgaatgaaggaaaaaatgaggtcagtacttcagctgctggccggttcgcattcccatcaaacgccacgtttgcctggggggatcgcgtacgcaagaagtctggcgctgcttggcaggggcgcattgtcgggtggtactgcacaacacttacccctgaaggctacgccgtcgagtccgaatctcacccaggctcagtccagatttatcccatgactgcgcttgaacgggtggcctga >>MEG_2561|Drugs|Trimethoprim|Dihydrofolate_reductase|DFRB atggaacgaagtagcaatgaagtcagtaatccagttgctggcaattttgtattcccatcgaacgccacgtttggtatgggagatcgcgtgcgcaagaaatccggcgccgcctggcaaggtcagattgtcgggtggtactgcacaaatttgacccccgaaggctacgccgtcgagtctgaggctcacccaggctcagtacagatttatcctgttgcggcgcttgaacgcatcaactga >>MEG_2562|Drugs|Trimethoprim|Dihydrofolate_reductase|DFRB atgggtcaaagtagccatgaagccaacgctcccgttgcagggcagtttgcacttcccctgagtgccacctttggcttcggagatcgcgtacgcaagaaatctggtgccgcttggcagggtcaagtcgtcggttggtattgcacaaaactcactcctgaaggctatgcggtcgagtccgaatcccacccaggctcagtgcaaatttatcctgtggctgcacttgaacgtgtggcctaa >>MEG_2563|Drugs|Trimethoprim|Dihydrofolate_reductase|DFRB ATGGACCAAGGCAGAAGTGAAGTCAGTAATCCAGTTGCTGGCCAGTTTGCGTTCCCTTCAAACGCCGCGTTCGGAATGGGAGATCGCGTGCGCAAGAAATCTGGCGCCGCTTGGCAAGGCCAGATTGTCGGGTGGTACTGCACAAAATTGACCCCTGAAGGGTACGCTGTCGAGTCTGAGGCTCACCCTGGCTCGGTACAGATTTATCCTGTTGCGGCACTGGAACGCATCAACTGA >>MEG_2564|Drugs|Trimethoprim|Dihydrofolate_reductase|DFRB ATGCAGCGTGTCGTCGGGCCACATAGAACACCTAGAAGTTCACAAGAAAGGTCGGAAATGGAACGAAGTAGCAATGAAGTCAGTAATCCAGTTGCTGGCAATTTTGTATTCCCATCGAACGCCACGTTTGGTATGGGAGATCGCGTGCGCAAGAAATCCGGCGCCGCCTGGCAAGGTCAGATTGTCGGGTGGTACTGCACAAATTTGACCCCCGAAGGCTACGCCGTCGAGTCTGAGGCTCACCCAGGCTCAGTACAGATTTATCCTGTTGCGGCGCTTGAACGCATCAACTGA >>MEG_2565|Drugs|Trimethoprim|Dihydrofolate_reductase|DFRB ATGGGTCAAAGTAGCGATGAAGCCAACGCTCCCGTTGCAGGGCAGTTTGCGCTTCCCCTGAGTGCCACCTTTGGCTTAGGGGATCGCGTACGCAAGAAATCTGGTGCCGCTTGGCAGGGTCAAGTCGTCGGTTGGTATTGCACAAAACTCACTCCTGAAGGCTATGCGGTCGAGTCCGAATCCCACCCAGGCTCAGTGCAAATTTATCCTGTGGCTGCACTTGAACGTGTGGCCTAA >>MEG_2566|Drugs|Trimethoprim|Dihydrofolate_reductase|DFRB ATGGACCAACACAACAATGGAGTCAGTACTCTAGTTGCTGGCCAGTTTGCGCTCCCATCGCACGCCACGTTTGGCCTGGGAGATCGCGTGCGCAAGAAATCTGGCGCCGCTTGGCAGGGTCAAGTTGTCGGGTGGTACTGCACAAAACTGACCCCTGAAGGCTATGCCGTCGAGTCCGAGTCTCACCCCGGTTCAGTACAGATTTATCCTGTGGCTGCGCTTGAACGCGTGGCCTGA >>MEG_2567|Drugs|Trimethoprim|Dihydrofolate_reductase|DFRB ATGGACCAAGGTAGCAATGAAGTCATTAATCCAGTCGCTGGCCAGTTTGCGTCCCCATCGAACGCCACGTTTGGTATGGGAGATCGCGTGCGCAAGAAATCTGGCGCCGCCTGGCAAGGTCAGATTGTCGGGTGGTACAGCACAAAGTTGACCCCTGAAGGCTACGCTGTCGAGTCTGAGGCTCACCCTGGCTCGGTGCAGATTTATCCTGTTGCCGCGCTTGAACGCGTCAACTGA >>MEG_2568|Drugs|Trimethoprim|Dihydrofolate_reductase|DFRB ATGGACCAAGGTAGCAATGAAGTCGGTAATCCAGTTGCGGGCCAGTTTTCGTTCCCATCGAACGCCGCGTTTAGTATGGGAGATCGCGTGCGCAAGAAATCGGGCGCCGCTTGGCAAGGTCAGATTGTCGGGTGGTACTGCACAAAGTTGACCCCTGAAGGCTACGCTGTCGAGTCTGAGGCTCACCCTGGCTCGGTACAGATTTATCCTGTTGCGGCGCTTGAACGCATCAACGGAGTTCAAGGTTGA >>MEG_2569|Drugs|Trimethoprim|Dihydrofolate_reductase|DFRB ATGAATGAAGGAAAAAATGAGGTCAGTACTTCAGCTGCTGGCCGGTTCGCATTCCCATCAAACGCCACGTTTGCCTTGGGGGATCGCGTACGCAAGAAGTCTGGCGCTGCTTGGCAGGGGCGCATTGTCGGGTGGTACTGCACAACACTTACCCCTGAAGGCTACGCCGTCGAGTCCGAATCTCACCCAGGCTCAGTCCAGATTTATCCCATGACTGCGCTTGAACGGGTGGCCTGA >>MEG_2570|Drugs|Trimethoprim|Dihydrofolate_reductase|DFRB ATGGACCAACACAACAATGGAGTCAGTACTCTAGTTGCTGGCCAGTTTGCGCTCCCATCGCACGCCACGTTTGGCCTGGGAGATCGCGTGCGCAAGAAATCTGGCGCCGCTTGGCAGGGTCAAGTTGTCGGGTGGTACTGCACAAAACTGACCCCTGAAGGCTATGCCGTCGAGTCCGAGTCTCACCCCGGTTCAGTACAGATTTACCCTGTGGCTGCGCTTGAACGCGTGGCCTGA >>MEG_2571|Drugs|Trimethoprim|Dihydrofolate_reductase|DFRB ATGGATCAAAGTAGTAAGGAAGTCAGTTCTCCAGCTACTGACCAGTTTGCGCTCCCATTCCGCGCCACGTTTGGCCTGGGAGATCGCGTACGCAAGAAATCTGGCGCCGCTTGGCAGGGTCAAGTTGTCGGCTGGTACAGCACAAAACTAACCCCAGAAGGCTATGCCGTCGAGTCCGAGTCTCATCCGGGCTCTGTACAAATCTATCCTGTTGCCGCGCTTGAACGCGTGGCCTAA >>MEG_2572|Drugs|Trimethoprim|Dihydrofolate_reductase|DFRC|RequiresSNPConfirmation ATGACATTATCAATAATTGTCGCTCACGATAAACAAAGAGTCATTGGGTACCAAAATCAATTACCTTGGCACTTACCAAATGATTTAAAGCATGTTAAACAACTGACCACTGGGAATACACTTGTAATGGGACGGAAAACTTTTAATTCTATAGGGAAACCATTGCCAAATAGACGTAACGTCGTACTCACTAACCAAGCTTCATTTCACCATGAAGGGGTAGATGTTATAAACTCTCTTGATGAAATTAAAGAGTTATCTGGTCATGTTTTTATATTTGGAGGACAAACGTTATTCGAGGCAATGATTGACCAGGTAGATGATATGTATATCACAGTAATAGATGGAAAGTTTCAAGGAGACACATTCTTTCCACCATACACATTCGAAAACTGGGAAGTCGAATCTTCAGTAGAAGGTCAACTAGATGAAAAAAATACTATACCGCATACATTCTTACATTTAGTGCGTAGAAAAGGGAAATAG >>MEG_2573|Drugs|Trimethoprim|Dihydrofolate_reductase|DFRC|RequiresSNPConfirmation ATGACATTATCAATAATTGTCGCTCACGATAAACAAAGAGTCATTGGGTACCAAAATCAATTACCTTGGCACTTACCAAATGATTTAAAGCATATTAAACAACTGACCACTGGGAATACACTTGTAATGGCACGGAAAACTTTTAATTCTATAGGGAAGCCATTGCCAAATAGACGTAACGTCGTACTCACTAACCAAGCTTCATTTCACCATGAAGGGGTAGATGTTATAAACTCTCTTGATGAAATTAAAGAGTTATCTGGTCATGTTTTTATATTTGGAGGACAAACGTTATACGAAGCAATGATTGACCAGGTAGATGATATGTATATCACAGTAATAGATGGAAAGTTTCAAGGAGACACATTCTTTCCACCATACACATTCGAAAACTGGGAAGTCGAATCTTCAGTAGAAGGTCAACTAGATGAAAAAAATACTATACCGCATACATTCTTACATTTAGTGCGTAGAAAAGGGAAATAG >>MEG_2574|Drugs|Trimethoprim|Dihydrofolate_reductase|DFRD ATGTGGTCATTCTTGAAAATTTCTTTAATTGTTGCGATGGATAAGAAAAGAGTAATCGGCAAGGATAACGACATTCCATGGAGAATTTCTAGTGATTGGGAATATGTAAAAAACACTACAAAAGGACATGCAATCATATTAGGTAGAAAGAACCTTCAATCAATCGGAAGGGCTTTACCTGACAGAAGAAATATTATTTTGACTAGAGATAAAAACTTTAACTTTAAGGATTGTGAAATTGCCCATTCAATAGAAGCTGCATTTAAGTTATGCGAAAATGAAGAAGAGGTTTTCATTTTCGGGGGAGAACAGATATATGTTATGTTCTTGCCTTATGTCGAGAAAATGTACGTTACAAAAATTCATCATGAATTCGAAGGAGATACATTTTTTCCAGTAGTTAATTTTGACGATTGGAAAGAAGTATCTGTTGAAAAAGGAATAAAAGATGAAAAGAATCCTTACGATTATTATTTTCATATATATGAGAGAATTCGTTAA >>MEG_2575|Drugs|Trimethoprim|Dihydrofolate_reductase|DFRD TTGAAAATTTCTTTAATTGTTGCGATGGATAAGAAAAGAGTAATCGGCAAGGATAACGACATTCCATGGAGAATTTCTAGTGATTGGGAATATGTAAAAAACACTACAAAAGGACATGCAATCATATTAGGTAGAAAGAACCTTCAATCAATCGGAAGGGCTTTACCTGACAGAAGAAATATTATTTTGACTAGAGATAAAAACTTTAACTTTAAGGATTGTGAAATTGCCCATTCAATAGAAGCTGCATTTAAGTTATGCGAAAATGAAGAAGAGGTTTTCATTTTCGGGGGAGAACAGATATATGTTATGTTCTTGCCTTATGTCGAGAAAATGTACGTTACAAAAATTCATCATGAATTCGAAGGAGATACATTTTTTCCAGTAGTTAATTTTGACGATTGGAAAGAAGTATCTGTTGAAAAAGGAATAAAAGATGAAAAGAATCCTTACGATTATTATTTTCATATATATGAGAGAATTCGTTAA >>MEG_2576|Drugs|Trimethoprim|Dihydrofolate_reductase|DFRD GTAAAATAGGTTAAAAAGGATGTGGTCATTCTTGAAAATTTCTTTAATTGTTGCGATGGATAAGAAAAGAGTAATCGGCAAGGATAACGACATTCCATGGAGAATTTCTAGTGATTGGGAATATGTAAAAAACACTACAAAAGGACATGCAATCATATTAGGTAGAAAGAACCTTCAATCAATCGGAAGGGCTTTACCTGACAGAAGAAATATTATTTTGACTAGAGATAAAAACTTTAACTTTAAGGATTGTGAAATTGCCCATTCAATAGAAGCTGCATTTAAGTTATGCGAAAATGAAGAAGAGGTTTTCATTTTCGGGGGAGAACAGATATATGTTATGTTCTTGCCTTATGTCGAGAAAATGTACGTTACAAAAATTCATCATGAATTCGAAGGAGATACATTTTTTCCAGTAGTTAATTTTGACGATTGGAAAGAAGTATCTGTTGAAAAAGGAATAAAAGATGAAAAGAATCCTTACGATTATTATTTTCATATATATGAGAGAATTCGTTAA >>MEG_2577|Drugs|Trimethoprim|Dihydrofolate_reductase|DFRE ATGTTAGCAGCTATTTGGGCCCAAGATGAACAAGGAGTGATTGGTAAAGAAGGCAAATTGCCTTGGCATTTACCCAATGACTTGAAATTTTTCAAGGAAAAAACAATTCATAATACATTGGTCTTAGGACGTGCAACTTTCGAAGGCATGGGATGTCGTCCGCTACCAAATCGAACAACGATTGTCCTAACCAGTAATCCGGATTACCGAGCTGAAGGCGTTTTGGTTATGCATTCCGTAGAGGAAATTCTTGCGTATGCTGACAACTATGAAGGTGTGACCGTTATTGGTGGAGGTTCTGTCGTTTTTAAAGAACTGATTCCCGCATGCGATGTCTTATATCGGACGATGATTCATGAAACGTTTGAAGGCGACACTTTCTTTCCAGAAATCGACTGGTTTGTTTGGGAAAAAGTTGCCACTGTTCCCGGCGTCGTGGACGAGAAAAATCTCTATGCACATGACTATGAAACGTATCATCGAAACGATAAATAA >>MEG_2578|Drugs|Trimethoprim|Dihydrofolate_reductase|DFRF ATGATAGGTTTGATTGTTGCGAGGTCAAAGAATAATGTTATAGGCAAGAATGGTAATATACCATGGAAAATAAAGGGAGAACAAAAGCAATTTAGAGAGTTAACAACGGGTAATGTGGTTATTATGGGGCGAAAGTCTTATGAAGAAATCGGTCATCCGTTGCCTAATAGAATGAATATTGTTGTTTCCACCACAACAGAGTATCAAGGAGATAATTTAGTTTCAGTTAAATCATTAGAAGATGCATTATTATTGGCTAAAGGACGAGATGTATACATATCTGGTGGATATGGACTATTTAAGGAAGCTTTGCAAATAGTAGATAAAATGTATATCACAGAAGTAGATTTAAATATTGAAGATGGAGATACATTCTTTCCAGAATTTGATATCAATGATTTTGAAGTTTTGATAGGGGAAACACTTGGTGAGGAAGTGAAATATACGAGAACATTTTATGTAAGGAAAAATGAATTGAGTAGATTTTGGATTTAG >>MEG_2579|Drugs|Trimethoprim|Dihydrofolate_reductase|DFRG ATGAAAGTTTCTTTGATTGCTGCGATGGATAAGAATAGAGTGATTGGCAAAGAGAATGACATTCCTTGGAGGATTCCCAAGGACTGGGAATATGTTAAAAATACTACAAAGGGACATCCGATAATATTAGGTAGGAAGAACCTTGAATCAATCGGAAGAGCCTTACCTGACAGAAGAAATATTATTCTGACGAGAGATAAGGGGTTTACCTTTAATGGTTGTGAAATTGTTCATTCAATAGAAGATGTTTTTGAGTTATGTAAAAACGAAGAAGAAATTTTTATTTTCGGAGGAGAACAGATTTATAATTTGTTTTTCCCTTATGTTGAGAAAATGTACATCACAAAAATACATCATGAATTCGAAGGAGATACTTTTTTTCCAGAAGTGAATTATGAGGAATGGAATGAGGTATTTGCCCAAAAAGGGATAAAGAATGATAAAAATCCGTATAACTACTATTTTCATGTATATGAAAGAAAAAACTTATTGAGTTAA >>MEG_2580|Drugs|Trimethoprim|Dihydrofolate_reductase|DFRI ATGAATCAAAACAGAGACGACCATAATCGTGCAGCAGATAGAGAAAAAACAGCAGAGAAAAGAGGAGAAAACCAGTGCATCATCTCCCTTATTTTAGCAATGGCAGATAATGGCACAATTGGTGATAAAAATGCCCTACCATGGCATCTTCCTAATGATCTGCAATTTTTAAAAAAGAGCACTATGGGAAAGCCGATTGTTATGGGCCGAAAAACTTACCAATCGATTGGCCGGCCACTTCCCGGCAGAACCAATGTAGTAATCTCACGCTCTTTAGAGAAGGAGGCTCTCCCCGGATGCTTAATCTATTCCGATCTCTCAGTTGCGATAGCGGCACTTAAAAAAGAGCCCGAGGTTGAAGAGATTATGATTATGGGGGGCGCGCAGATCTATAGAGCAGCTCTTCCTATGATGGATCGACTCTATCTTACCCATGTACATGCCAATATCGAAGGGGATACCCAGATGCCCCCCTTTGATTTTAGCCATGCAACCCTCATCTTTGAAGAGAAGCATTTTAAAGATGAGAAGAATCGATATGATTACACCTTTGAGATTTGGGACTTCAAAAAATAG >>MEG_2581|Drugs|Trimethoprim|Dihydrofolate_reductase|DFRK ATGAAAGTTTCTTTAATTGCTGCGATGGATAAGAACAGGGTAATAGGTAAAGAGAATGACATACCTTGGAGAATCCCAGAGGATTGGGAGTATGTTAAAAATACTACAAAGGGATATCCAATTATATTAGGAAGGAAGAATCTTGAATCAATCGGAAGAGCATTACCTGGAAGAAGGAATATTATTCTGACAAGAGATAAGGGGTTCAGCTTTAATGGTTGTGAAATCGTCCATTCAATAGAAGATGTTTTTGAGTTATGTAATAGCGAAGAGGAAATTTTCATTTTCGGGGGAGAACAAATTTATAATTTGTTTCTACCATATGTTGAGAAAATGTACATTACAAAAATTCATTACGAATTTGAAGGAGATACATTCTTTCCAGAAGTGAATTATGAAGAGTGGAACGAAGTATCTGTTACACAAGGAATAACAAATGAAAAAAATCCTTATACATATTATTTTCATATTTATGAGCGAAAAGCTTCTTGA >>MEG_2582|Drugs|Trimethoprim|Dihydrofolate_reductase|DFRK ATGAAAGTTTCTTTAATTGCTGCGATGGATAAGAATAGGGTATTAGGTAAAGAGAATGACATACCTTGGAGAATCCCAAAGGATTGGGAGTATGTTAAAAATACTACAAAGGGATATCCAATTATATTAGGAAGGAAGAATCTTGAATCAATCGGAAGAGCATTACCTGGAAGAAGAAATATTATTCTGACAAGAGATAAGGGTTTCAGCTTTAATGGTTGTGAAATTGTCCATTCAATAGAAGATGTTTTTGAGATATGTAATAACGAAGAGGAAATTTTCATTTTCGGGGGAGAACAAATTTATAATTTGTTTCTACCATATGTTGAGAAAATGTACATTACAAAAATTCATTACGAATTTGAAGGAGATACATTCTTTCCAGAAGTGAATTATGAAGAGTGGAGCGAAGTATCTGTTACACAAGGAATAACAGATGAAAAAAATCCTTATACATACTATTTTCATATTTATGAGCGAAAAGCTTCTTGA >>MEG_2583|Drugs|Trimethoprim|Dihydrofolate_reductase|DFRK ATGAAAGTTTCTTTAATTGCTGCGATGGATAAGAATAGGGTATTAGGTAAAGAGAATGACATACCTTGGAGAATCCCAAAGGATTGGGAGTATGTTAAAAATACTACAAAGGGATATCCAATTATATTAGGAAGGAAGAATCTTGAATCAATCGGAAGAGCATTACCTGGAAGAAGAAATATTATTCTGACAAGAGATAAGGGTTTCAGCTTTAATGGTTGTGAAATTGTCCATTCAATAGAAGATGTTTTTGAGATATGTAATAACGAAGAGGAAATTTTCATTTTCGGGGGAGAACAAATTTATAATTTGTTTCTACCATATGTTGAGAAAATGTACATTACAAAAATTCATTACGAATTTGAAGGAGATACATTCTTTCCAGAAGTGAATTATGAAGAGTGGAGCGAAGTATCTGTTACACAAGGAATAACAGATGAAAAAAATCCTTATACATACTATTTTCATATTTATGAACGAAAAGCTTATTGA >>MEG_2615|Drugs|Trimethoprim|Dihydrofolate_reductase|DHFR|RequiresSNPConfirmation GTGAAGTTATCACTAATGGCTGCCAAGTCGAAGAACGGTATTATCGGTAATGGACCAGATATTCCATGGAGCGCCAAAGGGCAGCAACTTCTATTTAGGGCAATTATATATAATCAATGGCTTTTAGTTGGACGCAAAACTTTTGAGTCAATGGGCGCTCTCCCAAATCGAAAGTATGCAGTTGTAACTCGCTCTAATTTTTCTACGAATGATGAGGGTGTAATGGTTTTCTCCTCAATTCAGGATGCCTTAATAAATTTAGAGGAAATCACGGATCATGTTATCGTTTCTGGTGGTGGTGAAATATACAAAAGCTTGATTTCCAAAGTAGATACTTTGCATATTTCAACAGTCGACATCGAGCGAGATGGAGACATAGTTTTTCCTGAAATCCCAGATACATTCAAGTTGGTATTTGAGCAAGATTTCGAGTCTAACATTAACTATTGTTATCAAATCTGGCAAAAGAGTTAA >>MEG_2616|Drugs|Trimethoprim|Dihydrofolate_reductase|DHFR|RequiresSNPConfirmation ATGAACCCGGAATTGGTCCGCATTTATCTGGTCGCTGCCATGGGTGCCAATCGGGTTATTGGCAATGGCCCCGATATTCCCTGGAAAATCCCGGGTGAGCAAAAGATCTTTCGCAGGCTCACCGAGGGCAAAGTGGTCGTTATGGGCCGCAAGACGTTTGAGTCCATAGGCAAGCCCTTACCAAACCGCCGCACAGTGGTGCTCTCGCGCCAAGCCAGTTATAGCGCTGCTGGTTGTGCAGTTGTTTCAACGCTGTCGCAGGCTATTGCCATCGCAGCCGAACACGGCAAAGAGCTCTACGTGGCCGGCGGAGCCGAGGTATATGCACTGGCACTACCTCGTGCCGACGGCGTCTTTCTATCTGAGGTACATCAAACCTTCGAGGGTGACGCCTTCTTCCCTGTGCTCGACGAAGCAGAATTCGAGGTTGTCTCAGCCGAAACCGTTCAAGCCACAATCACGTACACGCACTCCGTCTATGCACGTCGTAACGGCTAA >>MEG_2617|Drugs|Trimethoprim|Dihydrofolate_reductase|DHFR|RequiresSNPConfirmation ATGCCAACAGTTGAGATTATTGTTGCAGTTGATCCTGTTGGGGGATTTGGCCGGAATGGCCAAATCCCTTGGACGTGCAAGGAAGACATGAAGCGCTTCACCACCATATCCAAAGAGATTCGAGTGTGTGTGATGGGGAAGAACACATACAAAGACATGCTCGATATGCAAATGAAGAAGGAAGGCGCTGAAGAACGAATCAAAGAGAAGGGAATTCTTCCGGAGCGCGAATCTTACGTCGTGTCCTCGACTTTGAAGCCCGAGGACGTCATTGGAGCCACGGTAGTTCCGGACCTACGTGCGGTGCTCAATCAATATCACGACAGCGATCAACGAATAGCTGTCATTGGTGGAGAAAAGCTGTACGTGCAAGCCCTCGCATCTGCCACAAAAGTCCACATGACGGTAATGCACAAGCCATATAACTGCGATCGGACGTTGCCGATGTCATACATCGACAAAAAGTTTGTTGCAGGTCAAGGGTCTATCACCATTCAAACTGCGGTAGATGGTGAGACCCATCCCGTGAAGTTCATCACATATGAGCGCGCTCGGCCGTAA >>MEG_2618|Drugs|Trimethoprim|Dihydrofolate_reductase|DHFR|RequiresSNPConfirmation GTGAAACTATCACTAATGGTAGCTATATCGAAGAATGGAGTTATCGGGAATGGCCCTGATATTCCATGGAGTGCCAAAGGTGAACAGCTCCTGTTTAAAGCTATTACCTATAACCAATGGCTGTTGGTTGGACGCAAGACTTTTGAATCAATGGGAGCATTACCCAACCGAAAGTATGCGGTCGTAACACGTTCAAGTTTTACATCTGACAATGAGAACGTATTGATCTTTCCATCAATTAAAGATGCTTTAACCAACCTAAAGAAAATAACGGATCATGTCATTGTTTCAGGTGGTGGGGAGATATACAAAAGCCTGATCGATCAAGTAGATACACTACATATATCTACAATAGACATCGAGCCGGAAGGTGATGTTTACTTTCCTGAAATCCCCAGCAATTTTAGGCCAGTTTTTACCCAAGACTTCGCCTCTAACATAAATTATAGTTACCAAATCTGGCAAAAGGGTTAA >>MEG_2619|Drugs|Trimethoprim|Dihydrofolate_reductase|DHFR|RequiresSNPConfirmation TTGAAAGTATCATTGATGGCTGCGAAAGCGAAAAACGGCGTGATTGGTTGCGGTCCAGACATACCCTGGTCCGCGAAAGGGGAGCAGCTACTTTTTAAAGCATTGACCTACAATCAGTGGCTTCTGGTGGGTCGCAAGACGTTTGAATCTATGGGCGCACTCCCCAATAGGAAATACGCGGTCGTTACCCGCTCAGGTTGGACATCAAATGATGACAATGTAGTTGTATTTCAGTCAATCGAAGAGGCCATGGACAGGCTAGCTGAATTCACCGGTCACGTTATAGTGTCTGGTGGCGGAGAAATTTACCGAGAAACATTACCCATGGCCTCTACGCTCCACTTATCGACGATCGACATCGAGCCAGAGGGGGATGTTTTCTTCCCGAGTATTCCAAATACCTTCGAAGTTGTTTTTGAGCAACACTTTACTTCAAACATTAACTATTGCTATCAAATTTGGAAAAAGGGTTAA >>MEG_2620|Drugs|Trimethoprim|Dihydrofolate_reductase|DHFR|RequiresSNPConfirmation ATGGCAGCAATTTCGAAGAATGGAGTTATCGGAAATGGCCCAGATATTCCATGGAGTGCCAAAGGGGAACAATTACTCTTCAAAGCGATTACCTATAATCAGTGGCTTTTGGTAGGCCGAAAGACTTTCGAGTCAATGGGGGCTTTACCCAACCGAAAATATGCCGTTGTAACTCGTTCAAGCTTCACTTCCAGTGATGAGAATGTATTGGTATTTCCATCTATCGATGAAGCGCTAAATCATCTGAAGACGATAACGGATCATGTGATTGTGTCTGGTGGTGGTGAAATATACAAAAGCCTGATCGATAAAGTTGATACTTTACATATTTCAACAATCGACATTGAGCCAGAAGGTGATGTCTATTTTCCAGAAATCCCCAGTAGTTTTAGGCCAGTTTTTAGCCAAGACTTCGTGTCTAACATAAATTATAGTTACCAAATCTGGCAAAAGGGTTAA >>MEG_2621|Drugs|Trimethoprim|Dihydrofolate_reductase|DHFR|RequiresSNPConfirmation GTGAAACTATCACTAATGGCAGCAATTTCGAAGAATGGAGTTATCGGAAATGGCCCAGATATTCCATGGAGTGCCAAAGGGGAACAATTACTCTTCAAAGCGATTACCTATAATCAGTGGCTTTTGGTAGGCCGAAAGACTTTCGAGTCAATGGGGGCTTTACCCAACCGAAAATATGCCGTTGTAACTCGTTCAAGCTTCACTTCCAGTGATGAGAATGTATTGGTATTTCCATCTATCGATGAAGCGCTAAATCATCTGAAGACGATAACGGATCATGTGATTGTGTCTGGTGGTGGTGAAATATACAAAAGCCTGATCGATAAAGCTGATACTTTACATATTTCAACAATCGACATTGAGCCAGAAGGTGATGTCTATTTTCCAGAAATCCCCGGTAGTTTTAGGCCAGTTTTTAGCAAAGACTTCGTGTCCAACATAAATTATAGTTACCAAATCTGGCAAAAGGGTTAA >>MEG_2622|Drugs|Trimethoprim|Dihydrofolate_reductase|DHFR|RequiresSNPConfirmation TTGAAAATTTCTTTAATCGCAGCTCAGTCAGAAAACGGTGTTATTGGTAATGGCCCAGATATTCCATGGTCAGCAAAAGGGGAGCAGTTACTTTTCAAAGCGCTAACATATAATCAGTGGCTTCTTGTCGGAAGAAAAACATTTGAGTCAATGGGTATTCTTCCTAATCGAAAGTATGCTGTTCTTTCAAAAAATGGAATTTCACACCTTCCTGAAAACGTACTAGTTTTTTCGTCTATAGAAAATGCATTATATGAACTGGCTAAGGTAACAGACCATTTATATATTTCTGGCGGTGGTCAAATATATAATAGTCTTATTGAAAGTGCTGATACCATCCACTTATCTATCATCCACAAAGAGGTAGAAGGTGAAGTAAGGTTTCCCAAAATACCTCCTAATTACAAGTTGGTATTTGAGCAATATTATTCTTCAAATATTAATTACACTTATCAAATTTGGCAAAAAGGTT >>MEG_2623|Drugs|Trimethoprim|Dihydrofolate_reductase|DHFR|RequiresSNPConfirmation ATGAAAATATCCATTATGGCAGCAGTTTCTGAGAATGGAGTAATTGGCTCTGGATTGGATATACCTTGGCATGTACAAGGTGAGCAGCTCCTGTTCAAAGCTATGACTTACAATCATTGGCTTTTAGTCGGTCGTAAAACTTTCGACTCAATGGGTAAACTTCCCAATAGGAAATATGCTGTGGTTACTCGCTCAGAAATGGTCTCGAATGATCCAGATGTTATTTATTTCACCAGCATTGAATCGGCATTATCTTACTTAGACAATACGACAACACATGTCTTTGTTTCTGGTGGTGGTGAAATTTACAAAGCATTAATCGAACAAGCAGATGTTATCCATCTTTCAGTGATTCATAAGCACATCTCTGGCGACGTGTTTTTCCCTTCAGTTCCACAGAGTTTCAAACAAACATTTGAGCAAAGTTTCAGTTCAAATATTGATTACACGTACCAAATTTGGGCAAAGGGCTAA >>MEG_2624|Drugs|Trimethoprim|Dihydrofolate_reductase|DHFR|RequiresSNPConfirmation ATGAAAATATCTCTTATGGCAGCTGTTTCCGAGAATGGAGTAATTGGCTCTGGATTGGATATACCTTGGCATGTACAAGGCGAGCAGCTCCTATTCAAAGCCATGACTTACAATCAATGGCTTCTAGTTGGTCGTAAAACCTTCGACTCAATGGGTAAACTTCCGAATAGAAAATATGCAGTGGTTACTCGTTCTAAAATTATCTCGAATGACCCTGATGTTGTGTATTTCGCAAGTGTTGAATCGGCATTAGCTTACCTAAACAATGCGACAGCACATATCTTTGTTTCTGGTGGTGGTGAAATATATAAAGCTTTAATCGATCAAGCAGATGTTATCCATCTTTCAGTGATTCACAAGCATATCTCTGGCGATGTGTTTTTTCCTCCAGTTCCACAGGGCTTCAAGCAAACATTTGAGCAAAGTTTCAGTTCAAATATTGATTACACGTACCAAATTTGGGCAAAGGGCTAA >>MEG_2625|Drugs|Trimethoprim|Dihydrofolate_reductase|DHFR|RequiresSNPConfirmation GTGAAGTTATCACTAATGGCTGCCAAGTCGAAGAACGGTATTATCGGTAATGGACCAGATATTCCATGGAGCGCCAAAGGCGAGCAACTTCTATTTAAGGCAATTACATATAATCAATGGCTTTTAGTTGGACGCAAAACTTTTGAGTCAATGGGCGCTCTCCCAAATCGAAAGTATGCAGTTGTAACTCGCTCTAATTTTTCTACGAATGATGAGGGTGTAATGGTTTTCTCCTCAATTCAGGATGCCTTAATAAATTTAGAGGAAATCACGGATCATGTTATCGTTTCTGGTGGTGGTGAAATATACAAAAGCTTGATTTCCAAAGTAGATACTTTGCATATTTCAACAGTCGACATCGAGCGAGATGGAGACATAGTTTTTCCTGAAATCCCAGATACATTCAAGTTGGTATTTGAGCAAGATTTCGAGTCTAACATTAACTATTGTTATCAAATCTGGCAAAAGAGTTAA >>MEG_2626|Drugs|Trimethoprim|Dihydrofolate_reductase|DHFR|RequiresSNPConfirmation ATGGGTATTAAATATAGCTTAATTGTTGCAATTGGGAAACACCGAGAAATGGGTGCTGACAATGATTTGCTTTGGCACTTACCAAGAGATATGCAATTTTTTAAGGAAACGACAACGGGTCACGCTGTTGTAATGGGAAGAAAAAGTTGGGAATCTATTCCTCAGAAGTACAGACCGCTTCCAAATCGTTTAAACTTCGTTTTAACACGAGATAAAAACTATAGTGCAGAAGGTGCAACAGTGATTTATGATTTAAAAGAAGTCGCACAACATCTTGAAGGAAAAAACTTAACATGCTTCATTATTGGTGGTGCTCAAATCTACCAACTGGCCTTAGAAACAGGACTTTTAAATGAAATGTATGTCACACAAGTACATAACACATTTGAAGAAGCTGACACCTTTTTCCCTTTTGTAAATTGGGGAGAATGGGAAGAAGAAGATATTTTAGAACAAGATAAAGATGAAAAACATCTTTATTCATTTAATATAAAGAAATTTACGCGTTAA >>MEG_2627|Drugs|Trimethoprim|Dihydrofolate_reductase|DHFR|RequiresSNPConfirmation ATGACCTATCAGTTGGACGTGAGCAAAATTCTGTCGTTTGACCTGGAGGCCATCGTTGCTGCTACTGAGAACGGCGGCATCGGTTACAAAGGTGACCTCCCATGGCGTCTACAAGGCGATCTGAAGCGTTTTCGCGAAATCACCCAAGGCGGTATAGTCATCATGGGTGCAGGCACGTATAAGAGCCTCCCAAGTCCTCTGAAAGACCGCATCAATATCGTCATCACCAAGAAGTCAGAGATTTCTTGGACGGCTTGCTATGACGTGCGTGTGGTCAACAGTCCAGAAGACGCTTTGCGCATGGTTGGTCGCATTATCGACGAGAAAGAAGAGCAAGGTCGTGATCGACCTCGTGTATTCGTTATCGGCGGGGCTTCGATCTATCAGGCACTGATGCCTTTCGTTTCTACGCTCCACTGGACTGAGGTGCATGTTGAACAACTGCCAGAGGAAATCGGTCTCGATACGTATATCGAAGACTTCCTTTCTCTGCGTGGGACTTCTACACCGAAGAGAAAGTCGAATCTGGTTTTACCACCCACACCTACCACACCCTGA >>MEG_2628|Drugs|Trimethoprim|Dihydrofolate_reductase|DHFR|RequiresSNPConfirmation GTGAAAGTATCATTAATGGCTGCAAGAGCGAGAAACGGAGTGATCGGTTGCGGTCCACACATACCCTGGTCCGCGAAAGGAGAGCAGCTACTCTTTAAAGCCCTGACGTACAACCAGTGGCTTTTGGTTGGCCGCAAGACGTTCGAATCAATGGGGGCGCTCCCCAACAGGAAATACGCGGTCGTTACTCGCTCAGCCTGGACGGCCAATAATGACAACGTAGTAGTATTCCCGTCGATCGAAGAGGCCATGGGCGGTCTAGCTAAACTCAACGGTCACGTTATAGTGTCTGGTGGCGGGGAGATTTACAGAGAAACGTTGCCCATGGCCTCTACGCTCCATGTATCGACGATCGACATTGAGCCAGAAGGGGATGTTTTCTTCCCGAATATTCCCAACTTCTTCGAAGTTGTTTTTGAGCAACATTTTAGTTCAAACATTAACTATTGCTATCAAATTTGGAAAAAGGGTTAA >>MEG_2629|Drugs|Trimethoprim|Dihydrofolate_reductase|DHFR|RequiresSNPConfirmation ATGGCTGCAAGAGCGAAAAATGGCGTAATCGGTTGCGGTCCTGACATTCCTTGGTCTGCCAAAGGGGAACAGCTTCTTTTCAAAGCACTGACCTATAACCAATGGCTTTTGGTAGGGCGCAAAACATTTGAGTCTATGGGGCCGCTGCCCAATAGGAAATACGCGGTTGTTACCCGCTCAAACTGGACAGCGGCTAATGAAAACGTAGTGGTTTTCCCGTCGATTGACGAAGCGATGGGTAGATTAGGCGAGATCACTGACCATGTCATCGTCGCCGGTGGTGGAGAAATCTACCATGAAACGATACCCATGGCCTCTACTCTGCATGTGTCGACAATCGACGTTGAGCCAGAGGGAGACGTTTTCTTTCCGAACATTCCTGGGAAGTTTGATGTCGTTTTTGAGCAACAATTTACATCAAACATTAACTATTGCTATCAAATCTGGCAAAAGGGTTAA >>MEG_2630|Drugs|Trimethoprim|Dihydrofolate_reductase|DHFR|RequiresSNPConfirmation ATGAGAACCTTGAAAGTATCATTGATAGCTGCGAAAGCGAAAAACGGCGTGATTGGTTGCGGTCCAGACATACCCTGGTCCGCGAAAGGGGAGCAGCTACTTTTTAAAGCATTGACCTACAATCAGTGGCTTCTGGTGGGTCGCAAGACGTTTGAATCTATGGGCGCACTCCCCAATAGGAAATACGCGGTCGTTACCCGCTCAGGTTGGACATCAAATGATGACAATGTAGTTGTATTTCAGTCAATCGAAGAGGCCATGGACAGGCTAGCTGAATTCACCGGTCACGTTATAGTGTCTGGTGGCGGAGAAATTTACCGAGAAACATTACCCATGGCCTCTACGCTCCACTTATCGACGATCGACATCGAGCCAGAGGGGGATGTTTTCTTCCCGAGTATTCCAAATACCTTCGAAGTTGTTTTTGAGCAACACTTTACTTCAAACATTAACTATTGCTATCAAATTTGGAAAAAGGGTTAA >>MEG_2631|Drugs|Trimethoprim|Dihydrofolate_reductase|DHFR|RequiresSNPConfirmation ATGAACCCGGAATCGGTCCGCATTTATCTGGTCGCTGCCATGGGTGCCAATCGGGTTATTGGCAATGGCCCTGATATCCCTTGGAATATCCCTGGTGAGCAAAAGATTTTTCGCAGGCTCACCGAGGGCAAAGTGGTCGTTATGGGCCGCAAGACGTTTGAGTCCATAGGCAAGCCCTTACCAAACCGTCGCACAGTGGTGCTCTCGCGCCAAGCTAGTTATAGCGCTGCTGGTTGTGCAGTTGTTTCAACGCTGTCGCAGGCTATTGCCATCGCAGCCGAACACGGCAAGGAACTCTACGTGGCCGGCGGAGCCGAGGTATATGCACTGGCACTACCTCGTGCCGATGGCGTCTTTCTATCTGAGGTACATCAAACCTTCGAGGGTGACGCCTTCTTCCCAGCGCTCGACGCAGCAGAATTCGACGTTGTCTCAGCCGAAACCGTTCAAGCCACAATCACGTACACGCACTCCGTCTATGCACGTCGTAACGGCTAA >>MEG_2632|Drugs|Trimethoprim|Dihydrofolate_reductase|DHFR|RequiresSNPConfirmation TTGAAAATTTCATTGATTTCTGCAGTGTCAGAAAATGGCGTAATCGGTAGTGGTCCTGATATTCCGTGGTCAGCAAAAGGTGAGCAGCTAATCTTTAAGGCGCTCACATACAATCAGTGGCTTCTTGTTGGAAGGAAAACATTTGACTCTATGGGAGTTCTTCCAAATCGCAAATATGCAGTAGTGTCAAAGAATGGAATTTCAGGGTCAAATGAAAACGTCTTGGTTTTTCCTTCAATAGAAAATGCTTTGCAAGAACTATCTAAAATTACAGATCATGTATATATTTCGGGTGGGGGGCAAATCTATGAAAGCCTTATTGAAAAAGCAGATATAATTCATCTATCTACTATTCATGTTGAGGTTGAAGGTGATATTAAATTCCCTATATTACCTGAAGGTTTCAACTTGGTTTTTGAACAGTTTTTTGTGTCTAATATAAATTATACATATCAAATTTGGAAAAAAGGCTAA >>MEG_2633|Drugs|Trimethoprim|Dihydrofolate_reductase|DHFR|RequiresSNPConfirmation GTGAAACTATCACTAATGGCAGCAATTTCGAAGAATGGAGTTATCGGAAATGGCCCAGATATTCCATGGAGTGCCAAAGGGGAACAATTACTCTTCAAAGCGATTACCTATAATCAGTGGCTTTTGGTAGGCCGAAAGACTTTCGAGTCAATGGGGGCTTTACCCAACCGAAAATATGCCGTTGTAACTCGTTCAAGCTTCACTTCCAGTGATGAGAATGTATTGGTATTTCCATCTATCGATGAAGCGCTAAATCATCTGAAGACGATAACGGATCATGTGATTGTGTCTGGTGGTGGTGAAATATACAAAAGCCTGATCGATAAAGTTGATACTTTACATATTTCAACAATCGACATTGAGCCAGAAGGTGATGTCTATTTTCCAGAAATCCCCAGTAGTTTTAGGCCAGTTTTTAGCCAAGACTTCGTGTCTAACATAAATTATAGTTACCAAATCTGGCAAAAGGGTTAA >>MEG_2634|Drugs|Trimethoprim|Dihydrofolate_reductase|DHFR|RequiresSNPConfirmation ATGAACCCGGAATCGGTCCGCATTTATCTGGTCGCTGCCATGGGTGCCAATCGGGTTATTGGCAATGGTCCCGATATCCCCTGGAAAATCCCAGGTGAGCAGAAGATTTTTCGCAGGCTCACCGAGAGCAAAGTGGTCGTTATGGGCCGCAAGACATTTGAGTCCATAGGCAAGCCCTTACCAAACCGCCACACAGTGGTGCTCTCGCGCCAAGCTGGTTATAGCGCTCCTGGTTGTGCAGTTGTTTCAACGCTGTCACACGTATCGCCATCGACAGCCGAACACGGCAAAGAACTCTACGTAGCGCGCGGAGCCGAGGTATATGCGCTGGCGCTACCGCATGCCAACGGCGTCTTTCTATCTGAGGTACATCAAACCTTTGAGGGTGACGCCTTCTTCCCAGTGCTTAACGCAGCAGAATTCGAGGTTGTCTCATCCGAAACCATTCAAGGCACAATCACGTACACGCACTCCGTCTATGCGCGTCGTAACGGCTAA >>MEG_2635|Drugs|Trimethoprim|Dihydrofolate_reductase|DHFR|RequiresSNPConfirmation GTGAAACTATCACTAATGGTAGCTATATCGAAGAATGGAGTTATCGGGAATGGCCCTGATATTCCATGGAGTGCCAAAGGTGAACAGCTCCTGTTTAAAGCTATTACCTATAACCAATGGCTGTTGGTTGGACGCAAGACTTTTGAATCAATGGGAGCATTACCCAACCGAAAGTATGCGGTCGTAACACGTTCAAGTTTTACATCTGACAATGAGAACGTAGTGATCTTTCCATCAATTAAAGATGCTTTAACCAACCTAAAGAAAATAACGGATCATGTCATCGTTTCAGGTGGTGGGGAGATATACAAAAGCCTGATCGATCAAGTAGATACACTACATATATCTACAATAGACATCGAGCCGGAAGGTGATGTCTACTTTTCTGAAATCCCCAGCAATTTTAGGCCAGTTTTTACCCAAGACTTCGCCTCTAACATAAATTATAGTTACCAAATCTGGCAAAAGGGTTAA >>MEG_2636|Drugs|Trimethoprim|Dihydrofolate_reductase|DHFR|RequiresSNPConfirmation TTGAAAATTTCATTGATTTCTGCAACGTCAGAAAATGGCGTAATCGGTAATGGCCCTGATCTCCCATGGTCAGCAAAAGGTGAGCAGTTACTCTTTAAAGCGCTCACATATAATCAGTGGCTCCTTGTTGGAAGGAAAACATTTGACTCTATGGGTGTTCTTCCAAATCGAAAATATGCAGTAGTGTCGAGGAAAGGAATTTCAAGCTCAAATGAAAATGTATTAGTCTTTCCTTCAATAGAAATCGCTTTGCAAGAACTATCGAAAATTACAGATCATTTATATGTCTCTGGTGGCGGTCAAATCTACAATAGTCTTATTGAAAAAGCAGATATAATTCATTTGTCTACTGTTCACGTTGAGGTTGAAGGTGATATCAATTTTCCTAAAATTCCAGAGAATTTCAATTTGGTTTTTGAGCAGTTTTTTTTGTCTAATATCATTACACATATCAGATTTGGAAAAAAGGCTAACAAGTCGTTCCAGCACCAGCCTGCGCTCCTTGGACAGTTTTTAAGTCGCGGTTTTATGGTTTTCTGCGCAAAAGTATTCCATAAAACCACAACTTAA >>MEG_2637|Drugs|Trimethoprim|Dihydrofolate_reductase|DHFR|RequiresSNPConfirmation GTGAAACTATCACTAATGGTAGCTATATCGAAGAATGGAGTTATCGGGAATGGCCCTGATATTCCATGGAGTGCCAAAGGTGAACAGCTCCTGTTTAAAGCTATTACCTATAACCAATGGCTGTTGGTTGGACGCAAGACTTTTGAATCAATGGGAGCATTACCCAACCGAAAGTATGCGGTCGGAACACGTTCAAGTTTTACATCTGACAATGAGAACGTATTGATCTTTCCATCAATTAAAGATGCTTTAACCAACCTAAAGAAAATAACGGATCATGTCATTGTTTCAGGTGGTGGGGAGATATACAAAAGCCTGATCGATCAAGTAGATACACTACATATATCTACAATAGACATCGAGCCGGAAGGTGATGTTTACTTTCCTGAAATCCCCAGCAATTTTAGGCCAGTTTTTACCCAAGACTTCGCCTCTAACATAAATTATAGTTACCAAATCTGGCAAAAGGGTTAA >>MEG_2638|Drugs|Trimethoprim|Dihydrofolate_reductase|DHFR|RequiresSNPConfirmation ATGGCTGCCAAGTCGAAGAACGGTATTATCGGTAATGGACCAGATATTCCATGGAGCGCCAAAGGCGAGCAACTTCTATTTAAGGCAATTACATATAATCAATGGCTTTTAGTTGGACGCAAAACTTTTGAGTCAATGGGCGCTCTCCCAAATCGAAAGTATGCAGTTGTAACTCGCTCTAATTTTTCTACGAATGATGAGGGTGTAATGGTTTTCTCCTCAATTCAGGATGCCTTAATAAATTTAGAGGAAATCACGGATCATGTTATCGTTTCTGGTGGTGGTGAAATATACAAAAGCTTGATTTCCAAAGTAGATACTTTGCATATTTCAACAGTCGACATCGAGCGAGATGGAGACATAGTTTTTCCTGAAATCCCAGATACATTCGAGTTGGTATTTGAGCAAGATTTCGAGTCTAACATTAACTATTGTTATCAAATCTGGCAAAGAGTTAACAAGCGCCTGCAATCTGACCTCCGGTTACTGTCACCTTTTTTTGCGGTGGAGCTGCAAAAATGCGCCATTAACCTCCGGCAGTTGAGGCGGGCGTTAGATGCACTAGCACATAATTGCTCACAGCCAACTATCAGGTCAAGTCTGCTT >>MEG_2639|Drugs|Trimethoprim|Dihydrofolate_reductase|DHFR|RequiresSNPConfirmation ATGAAACTATCACTAATGGTAGCTATATCGAAGAATGGAGTTATCGGGAATGGCCCTGATATTCCATGGAGTGCCAAAGGTGAACAGCTCCTGTTTAAGGCTATTACCTATAACCAATGGCTGTTGGTTGGACGCAAGACTTTTGAATCAATGGGAGCATTACCCAACCGAAAGTATGCGGTCGTAACACGTTCAAGTTTTACATCTGACAATGAGAACGTAGTGATCTTTCCATCAATTAAAGATGCTTTAACCAACCTAAAGAAAATAACGGATCATGTCATTGTTTCAGGTGGTGGGGAGATATACAAAAGCCTGATCGATCAAGTAGATACACTACATATATCTACAATAGACATCGAGCCGGAAGGTGATGTTTACTTTCCTGAAATCCCCAGCAATTTTAGGCCAGTTTTTACCCAAGACTTCGCCTCTAACATAAATTATAGTTACCAAATCTGGCAAAAGGGTTAA >>MEG_2640|Drugs|Trimethoprim|Dihydrofolate_reductase|DHFR|RequiresSNPConfirmation GTGAAACTATCACTAATGGTAGCTATATCGAAGAATGGAGTTATCGGGAATGGCCCTGATATTCCATGGAGTGCCAAAGGTGAACAGCTCCTGTTTAAAGCTATTACCTATAACCAATGGCTGTTGGTTGGACGCAAGACTTTTGAATCAATGGGAGCATTACCCAACCGAAAGTATGCGGTCGTAACACGTCCAAGTTTTACATCTGACAATGAGAACGTAGTGATCTTTCCATCAATTAAAGATGCTTTAACCAACCTAAAGAAAATAACGGATCATGTCATTGTTTCAGGTGGTGGGGAGATATACAAAAGCCTGATCGATCAAGTAGATACACTACATATATCTACAATAGACATCGAGCCGGAAGGTGATGTTTACTTTCCTGAAATCCCCAGCAATTTTAGGCCAGTTTTTACCCAAGACTTCGCCTCTAACATAAATTATAGTTACCAAATCTGGCAAAAGGGTTAA >>MEG_2641|Drugs|Trimethoprim|Dihydrofolate_reductase|DHFR|RequiresSNPConfirmation AAGGAAACAGAAATGGGTATTAAATATAGCTTAATTGTTGCAATTGGGAAACACCGAGAAATGGGTGCTGACAATGATTTGCTTTGGCACTTACCAAGAGATATGCAATTTTTTAAGGAAACGACAACGGGTCACGCTGTTGTAATGGGAAGAAAAAGTTGGGAATCTATTCCTCAGAAGTACAGACCGCTTCCAAATCGTTTAAACTTCGTTTTAACACGAGATAAAAACTATAGTGCAGAAGGTGCAACAGTGATTTATGATTTAAAAGAAGTCGCACAACATCTTGAAGGAAAAAACTTAACATGCTTCATTATTGGTGGTGCTCAAATCTACCAACTGGCCTTAGAAACAGGACTTTTAAATGAAATGTATGTCACACAAGTACATAACACATTTGAAGAAGCTGACACCTTTTTCCCTTTTGTAAATTGGGGAGAATGGGAAGAAGAAGATATTTTAGAACAAGATAAAGATGAAAAACATCTTTATTCATTTAATATAAAGAAATTTACGCGTTAA >>MEG_2642|Drugs|Trimethoprim|Dihydrofolate_reductase|DHFR|RequiresSNPConfirmation GTGAAACTATCACTAATGGCAGCAATTTCGAAGAATGGAGTTATCGGAAATGGCCCAGATATTCCATGGAGTGCCAAAGGGGAACAATTACTCTTCAAAGCGATTACCTATAATCAGTGGCTTTTGGTAGGCCGAAAGACTTTCGAGTCAATGGGGGCTTTACCCAACCGAAAATATGCCGTTGTAACTCGTTCAAGCTTCACTTCCAGTGATGAGAATGTATTGGTATTTCCATCTATCGATGAAGCGCTAAATCATCTGAAGACGATAACGGATCATGTGATTGTGTCTGGTGGTGGTGAAATATACAAAAGCCTGATCGATAAAGCTGATACTTTACATATTTCAACAATCGACATTGAGCCAGAAGGTGATGTCTATTTTCCAGAAATCCCCGGTAGTTTTAGGCCAGTTTTTAGCCAAGACTTCGTGTCTAACATAAATTATAGTTACCAAATCTGGCAAAAGGGTTAA >>MEG_2643|Drugs|Trimethoprim|Dihydrofolate_reductase|DHFR|RequiresSNPConfirmation GTGAAACTATCACTAATGGTAGCTATATCGAAGAATGGGGTTATCGGGAATGGCCCTGATATTCCATGGAGTGCCAAAGGTGAACAGCTCCTGTTTAAAGCTATTACCTATAACCAATGGCTGTTGGTTGGACGCAAGACTTTTGAATCAATGGGAGCATTACCCAACCGAAAGTATGCGGTCGTAACACGTTCAAGTTTTACATCTGACAATGAGAACGTATTGATCTTTCCATCAATTAAAGATGCTTTAACCAACCTAAAGAAAATAACGGATCATGTCATTGTTTCAGGTGGTGGGGAGATATACAAAAGCCTGATCGATCAAGTAGATACACTACATATATCTACAATAGACATCGAGCCGGAAGGTGATGTTTACTTTCCTGAAATCCCCAGCAATTTTAGGCCAGTTTTTACCCAAGACTTCGCCTCTAACATAAATTATAGTTACCAAATCTGGCAAAAGGGTTAA >>MEG_2644|Drugs|Trimethoprim|Dihydrofolate_reductase|DHFR|RequiresSNPConfirmation ATGAGAACCTTGAAAGTATCATTGATAGCTGCGAAAGCGAAAAACGGCGTGATTGGTTGCGGTCCAGACATATCCTGGTCCGCGAAAGGGGAGCAGCTACTTTTTAAAGCATTGACCTACAATCAGTGGCTTCTGGTGGGTCGCAAGACGTTTGAATCTATGGGCGCACTCCCCAATAGGAAATACGCGGTCGTTACCCGCTCAGGTTGGACATCAAATGATGACAATGTAGTTGTATTTCAGTCAATCGAAGAGGCCATGGACAGGCTAGCTGAATTCACCGGTCACGTTATAGTGTCTGGTGGCGGAGAAATTTACCGAGAAACATTACCCATGGCCTCTACGCTCCACTTATCGACGATCGACATCGAGCCAGAGGGGGATGTTTTCTTCCCGAGTATTCCAAATACCTTCGAAGTTGTTTTTGAGCAACACTTTACTTCAAACATTAACTATTGCTATCAAATTTGGAAAAAGGGTTAA >>MEG_2645|Drugs|Trimethoprim|Dihydrofolate_reductase|DHFR|RequiresSNPConfirmation TTGAAAGTATCATTGATAGCTGCGAAAGCGAAAAACGGCGTGATTGGTTGCGGTCCAGACATACCGTGGTCCGCGAAAGGGGAGCAGCTACTTTTTAAAGCATTGACCTACAATCAGTGTCTTCTGGTGGGTCGCAAGACGTTTGAATCTATGGGCGCACTCCCCAATAGGAAATACGCGGTCGTTACCCGCTCAGGTTGGACATCAAATGATGACAATGTAGTTGTATTTCAGTCAATCGAAGAGGCCATGGACAGGCTAGCTGAATTCACCGGTCACGTTATAGTGTCTGGTGGCGGAGAAATTTACCGAGAAACATTACCCATGGCCTCTACGCTCCACTTATCGACGATCGACATCGAGCCAGAGGGGGATGTTTTCTTCCCGAGTATTCCAAATACCTTCGAAGTTGTTTTTGAGCAACACTTTACTTCAAACATTAACTATTGCTATCAAATTTGGAAAAAGGGTTAA >>MEG_2646|Drugs|Trimethoprim|Dihydrofolate_reductase|DHFR|RequiresSNPConfirmation GTGAAACTATCACTAATGGTAGCTATATCGAAGAATGGAGTTATCGGGAATGGCCCTGATATTCCATGGAGTGCCAAAGGTGAACAGCTCCTGTTTAAAGCTATTACCTATAACCAATGGCTGTTGGTTGGACGCAAGACTTTTGAATCAATGGGAGCATTACCCAACCGAAAGTATGCGGTCGTAACACGTTCAAGTTTTACATCTGACAATGAGAACGTAGTGATCTTTCCATCAATTAAAGATGCTTTAACCAACCTAAAGAAAATAACGGATCATGTCATTGTTTCAGGTGGTGGGGAGATATACAAAAGCCTGATCGATCAAGTAGATACACTACATATATCTACAATAGACATCGAGCCGGAAGGTGATGTTTACTTTCCTGAAATCCCCAGCAATTTTAGGCCAGTTTTTACCCAAGACTTCGCCTCTAACATAAATTATAGTTACCAAATCTGGCAAAAGGGTTAA >>MEG_2647|Drugs|Trimethoprim|Dihydrofolate_reductase|DHFRIII|RequiresSNPConfirmation ATGTTGATTTCTTTGATTGCAGCTTTGGCTCATAACAACTTGATTGGCAAAGATAATCTTATTCCATGGCATCTACCTGCCGATCTGCGTCATTTCAAAGCTGTCACCCTGGGGAAACCTGTGGTGATGGGACGTCGCACCTTTGAGTCGATCGGGCGGCCATTGCCAGGACGGCGCAATGTTGTCGTTAGTCGCAATCCCCAATGGCAGGCCGAAGGGGTGGAGGTGGCTCCCTCGCTGGATGCGGCTCTGGCGCTATTAACCGACTGTGAGGAAGCGATGATCATCGGTGGCGGGCAACTCTATGCCGAGGCTCTGCCCCGAGCGGATCGCTTGTATCTAACCTACATTGACGCTCAGTTGAACGGTGATACCCATTTCCCGGATTACCTATCGCTTGGGTGGCAGGAGTTGGAGCGGTCAACGCATCCTGCTGACGATAAGAACAGCTATGCCTGCGAATTTGTTACCTTGAGTCGTCAGCGCTGA