MEGAResFrom MEG, the Microbial Ecology Group

Notice: Trying to access array offset on value of type null in /home/meglabuser/megares.meglab.org/vendor/doctrine/annotations/lib/Doctrine/Common/Annotations/DocParser.php on line 967

TETR

Resistance to tetracycline is regulated by the tetR gene in gram-negative bacteria, and this gene has been shown to regulate multi-drug efflux as well. A protein family of this same name is also a transcriptional regulator class.

References

  • http://www.ncbi.nlm.nih.gov/pubmed/10700280,http://www.ncbi.nlm.nih.gov/protein/489204772

Notice: Trying to access array offset on value of type null in /home/meglabuser/megares.meglab.org/vendor/doctrine/annotations/lib/Doctrine/Common/Annotations/DocParser.php on line 967

Sequences

Download Sequences

>>MEG_7185|Drugs|Tetracyclines|Tetracycline_transcriptional_repressor|TETR|RequiresSNPConfirmation
ATGACAAAGTTGCAGCCGAATACAGTGATCCGTGCCGCCCTGGACCTGTTGAACGAGGTCGGCGTAGACGGTCTGACGAC
ACGCAAACTGGCGGAACGGTTGGGGGTTCAGCAGCCGGCGCTTTACTGGCACTTCAGGAACAAGCGGGCGCTGCTCGACG
CACTGGCCGAAGCCATGCTGGCGGAGAATCATACGCATTCGGTGCCGAGAGCCGACGACGACTGGCGCTCATTTCTGATC
GGGAATGCCCGCAGCTTCAGGCAGGCGCTGCTCGCCTACCGCGATGGCGCGCGCATCCATGCCGGCACGCGACCGGGCGC
ACCGCAGATGGAAACGGCCGACGCGCAGCTTCGCTTCCTCTGCGAGGCGGGTTTTTCGGCCGGGGACGCCGTCAATGCGC
TGATGACAATCAGCTACTTCACTGTTGGGGCCGTGCTTGAGGAGCAGGCCGGCGACAGCGATGCCGGCGAGCGCGGCGGC
ACCGTTGAACAGGCTCCGCTCTCGCCGCTGTTGCGGGCCGCGATAGACGCCTTCGACGAAGCCGGTCCGGACGCAGCGTT
CGAGCAGGGACTCGCGGTGATTGTCGATGGATTGGCGAAAAGGAGGCTCGTTGTCAGGAACGTTGAAGGACCGAGAAAGG
GTGACGATTGA

>>MEG_7186|Drugs|Tetracyclines|Tetracycline_transcriptional_repressor|TETR|RequiresSNPConfirmation
ATGACCAAACTGGACAAGGGCACCGTGATCGCGGCGGGCCTAGAGCTGTTGAACGAGGTTGGCATGGACAGCCTGACGAC
GCGGAAGCTCGCTGAACGCCTCAAGGTTCAGCAGCCTGCGCTTTACTGGCATTTCCAGAACAAACGAGCGCTGCTTGATG
CGCTGCCCGAGGCGATGCTGCGGGAACGCCATACCCGCTCGCTACCCGAAGAGAATGAGGACTGGCGGGTGTTCCTGAAA
GAGAATGCCCTGAGCTTCAGAACGGCGTTGCTCTCTTATCGGGACGGCGCGCGTATCCATGCCGGCACTCGACCGACAGA
ACCGAATTTTGGCACCGCCGAGACGCAAATACGCTTTCTCTGCGCGGAGGGCTTTTGTCCGAAGCGCGCCGTTTGGGCGC
TCCGGGCGGTCAGTCACTATGTGGTCGGTTCCGTTCTCGAGCAGCAGGCATCTGATGCCGATGAGAGAGTTCCGGACAGG
CCAGATGTGTCCGAGCAAGCACCGTCGTCCTTCCTGCACGTACTGTTTCACGAGTTGGAAACAGACGGCATGGATGCTGC
GTTCAACTTCGGACTCGACAGCCTCATCGCTGGTTTCGAGCGGCTGCGTGCTGCAGTGCTAGCGACAGATTGA

>>MEG_7187|Drugs|Tetracyclines|Tetracycline_transcriptional_repressor|TETR|RequiresSNPConfirmation
ATGAGCGAAAAAAATACTGCGGCGCGTTTAACGCGTGAAACGGTCCTGCGCGGGGCGCTGGCGTTACTGGATGACATCGG
CATCGATGCCCTGAGCACCCGCCGCCTGGCGCAGCATCTGGGCGTGCAATCCCCCACGCTCTATTGGCACTTCAAAAACA
AGGCCGAGCTGCTGAAGGCGATGGCGGAAACCATCATGTTGGACCACCGCGAAGAGGTGCCCGCCGACATGCCCTGGCAG
GCCTGGGTGACCGCCAATGCGATCAATTTCCGCCGCGCGTTGCTGGCTTACCGCGACGGGGCGCGCCTGCACGCCGGCAC
CCGGCCGCAGGAACCGCAATTCGCCATCATCGAGGCCAAGGTGGCGCTGCTGTGCCGGGCGGGCTTTACGCCGGAACACG
CCGTTAATCTGCTGTTCGCCGTCGGGCGTTTTGTGGTGGGTTGGGTGCTGGAAGAGCAGCAAATGCAGCCCGATGATGCG
CTGAACGAAGCCGATCGCCGGCGCTACCCGCTGCTGTGTGGAGGCTGGGAAAAGCTGCAGGACAAGGGGGCAGACGCGTT
GTTCGAAGCCGGCCTCCGGCTGTTGGTTGACGGCGCCGAGGCCGCGTTGACGAACGCCAATAATCACGGCGCGCAATCAT
AA

>>MEG_7188|Drugs|Tetracyclines|Tetracycline_transcriptional_repressor|TETR|RequiresSNPConfirmation
ATGGCTATCGGACGTGATCGCATTGTCGATGAGGCCCTGCGGCTCCTGAACGAGGTGGGAATAGACAAGCTGTCCACCCG
CAAGCTCGCGGAACGGCTGGGCGTCCAGCAGCCGGCGCTCTACTGGCACTTCCGCAACAAGGCGGAATTGCTCGACGCCA
TCAATTCCGAAATGCTGCTGCGTTATCACTGCGATCGCCTGCCCAAACCCGGCCAGGATTGGATTACGTTCACGCTGGCC
AATGCCCGCAGCATTCGCAAGACCTTGCTCACCGTGCGCGATGGCGCGCGGCTAACCGCAGGTACACGGCCTTCCGTCGC
CGAGTTTGCCGATGTGGAAAGCGTCTTGCAGCTCTATGTCGAGACGGGATTTTCCGCAGAGGAGGCATTTGGGATCGCCA
TTTGCATCACGCGCTATGTGGTCGGCTATGTGCTCGAAGAACAGGGAGAGCGCGAACGGGATCGGATGGATCAACACTCG
CCCAATACCGACATCATGGCAGAACTCGCACAGTTCCCCCTGCTTGCAAAAGCTCTTGAAAGCTTCCCCACGGTTGGAAC
GGTCAACACCGAAGCCGTGTTCGAGAGTGGGCTAAGTTACCTGCTGGCCGGTATGAAGGAGAAGCTGCGGGAGAAACAGT
CTAGATAG

>>MEG_7189|Drugs|Tetracyclines|Tetracycline_transcriptional_repressor|TETR|RequiresSNPConfirmation
ATGCCCAAGGTGCTCTCTGATGAAGACGTCGGTGAATTCCGTCAACGGCTCCTGAAAACCGCGGAAGCCGCGTTCGCCAC
GCACGGCGTCGACGGGGTTTCGATGCGCCAGCTCGCGCAGCAACTGGGGTGCAGCGCGACAACCCCTTATCGCTATTTCA
AGAACAAGGACGAGATCCTCGCGGCGGTCACGGCCGCGGCCTTGAACCGGTTCTCCGCAACGCTCGAAAAGGCGTTCGCC
GCCAAGGGCAGCAGCGCCGAGAAGGCGGTCGCGGTGCGCAAGGCCTACATCCGCTTCGCCTTCAAGAACCCCAAGGCCTA
TAGGCTGATGTTCGATGCGCCGCATCCGAGCCTGCTGGACTACGCCGATCTTTCAGAAGCCTCCAGCCGCGCGGACCGGA
TCATGGCCGCGCCCCTGGCTCTTCTGGCGCAAGAGGGCATCGTCAAGGGCGACTCCCGGCTCCTGGGGCGCGTGTTCTGG
AGCGCGATCCACGGCGCGGTTTCGCTGCAACTGGCCGGCAAGCTCGCGGCGAAACCCACATTCGAAGCCGTTCTCGAACA
GACATTGCAGCTGATCATGGCCGGCGCCATGGCGACCCGTCATTCCGCTTGA

>>MEG_7190|Drugs|Tetracyclines|Tetracycline_transcriptional_repressor|TETR|RequiresSNPConfirmation
ATGACGAACCCCGCACCTCTCGGTCGCCGCGAACGGAAGAAGGCCGCGACCCGCAAGGCGATCTCCGACGTCGCGACGGC
CATGTTCCTGGAACGCGGCTTCGATGAGGTGAGCATCCGCGAGGTCGCCGATGCCGCAGATGTCTCCCCCACGACCGTGT
TCGCGCACTTCCCTCAGAAGGAGGCGCTGGTGTTCGACGAAGACGACGAGCAGCGCGACCGCCTGGTGGCCGCCGTCCGC
GAGCGCCCGTCGGGGAGCACGATCAACCGCGCCATCCACGACTTCTACGCCTCAGAGCTCCGCGCGAACGTCGACGAGCA
CGGAGACGAGATCACTCGCACCTTCATGCGCTTCCTGAACGAGACACCGGCGCTGCGCGACTACGCGGCGAAGATGTGGC
TCCGACACGAAGACGCCCTCTCCGACGCGATCGCCGACGAACTGGGACTCGATACACCCACCCCGGAGATCCGGGTCTAC
TCGCGGTTCATCCTGCAGATGCAGCTGCTCGTCAACGAGAACGACGACCCCTTCGGGACGCTCGAAGCAGGGTTCGTGAT
CCTCGAGAACGGCTGGGCGCCGGTCGAAGCCGGCCTCAGCGGATCCGCCAGCTAG

>>MEG_7191|Drugs|Tetracyclines|Tetracycline_transcriptional_repressor|TETR|RequiresSNPConfirmation
ATGACTCACCACCGGAAGCGTCTCGACCGCACGTCCGTGTTGCTCGGGGCCCGGCAGGTGCTCGACGAGACTGGGCTCGA
TGGCTTCACCACTCGCGCGCTGGCGGCTCACTTACAGGTACAGCAGCCCGGCCTCTACTGGCACTTCCGCACGAAGGCCG
AACTCCTCGCAGCGCTGGCGAGCGACGTGCTTGACCGAGAGCATCACGCTTCCTTCCCCGAGTCCGACGAGAAATGGGAC
GCATTTCTCTTGCGAAACGCAAGAAGTTTCCGCCACGCACTACACGCGGTCCGTGACGGTGCGCGTCTCCACGCTGAGCA
CCACCGCAGACCATCCGGCGACGACACCGACGAAGGAGCTGAGGCTTCCGGTCAGCAAGTCGGGCTTCTCGTGTCTCAGG
GATTCGATGAACAGACAGCCATCAGCATGCTCATCGCGGTCAGCCGATACACCGTCGGTGTCGTACTGGAGGAGCAAACC
GCAGAGGTCGGCAATGCGAGCGTTCCTGAACGCGACCGGGAATTCGATTTCGGCCTGACAGCACTGATCGACGGATTCTC
TCACTCCCGCACAGCGTCATTGACCTCGAGCGAATCGTGA

>>MEG_7192|Drugs|Tetracyclines|Tetracycline_transcriptional_repressor|TETR|RequiresSNPConfirmation
TTGGGATACAGTCCTGTATTCGGGAAGCGCATCAAGGAGGCGGTCACCATCACGAAGCGACTCACCCGGCAGCAGAGCCG
GCAGGTCACCCGCGAGCAGATCCTCCGGTCGGCGGCCGCCCTCTTCGCGGGCCAGGGCGTCAGCGGAACCTCGGTGGAGC
AGATCGTCGAGTCCGCCGGATACACCCGCGGCGCCTTCTACGGCAACTTCGAGGGCAAGCACGAGCTCGTCCTCGCCCTG
CTGGAGCAGCGGACCCAGCACGAGCTCGAAGAGATCCAGGCGATGAGCCGCGAGGCGGCCACCTTCGAGGAGATGCTGGA
CCACCTGCGCTCCTGGCACCGACGGCGCGACGAGAACCTCGCCAGCTGGCTCGCGCTGCGCACCGAACTCTGGCTCTACG
GACTGCGCGACCCGGAGCTGCTGCCCCTGTTGGCGGACCGCGAGCGCCGCTCGCGGGACGCGATCGCCCAGTCGCTGGAG
CAGGGCTTCGCCGCACGCGGGGTGACCACCCCGGCGCCCGTGGAGCTCCTGGCACTGATCGTCCACGCGCTGGACGACGG
ACTGTCCATCCAGCGCGTGCTCTTCCCCTCCGACAGCGGCACGGACTCCGTCGTGGACGTGGTGGAGCTCCTCATGAAGT
CCTGGACCGCACTCGCCCGCAGCACCGCACCCGCACCCGCGGCCGAACCCGCCGCCGAACCCCCGACCGAGAAGCTGGAG
AAGAACCCATGA

>>MEG_7193|Drugs|Tetracyclines|Tetracycline_transcriptional_repressor|TETR|RequiresSNPConfirmation
GTGGTCGGCGTGGGGCTGAGGGAGCGCAAGAAACTGGACACCCGGCGGGCGCTGAGTGACGCCGCGCTGAGGCTGATGTT
CGAGCGCGGCCTGGAGAACGTCACGCGCGAAGACATCGCCAACCTGGCGGGCGTCTCCTTGCGCACGTTCACCAACTACT
TCAACGGCAAGTACGACGCATTGGCGTACCGCCAGGTCGAACGCATGCGGCGCAGCATCGAGACGCTGCGCAATCGTCCG
GTCGGTGAGCCGTTGTGGACGTCGGTCATTGAGGCCGTGTTGGAGCCGCTCGACGAGGACTTCGAGGACATGTATGGAGC
GGAGAACGTCCTGCCCACTCGCCAGCAGCTCGCCGAGGTCCGAAAACTGTTGATGGTGCCGGAGATCCGCGATGCGACGT
TCCGTGCGATGTTCGACGAATGGGTTGCGGTCATCGCCGAACGTACCGGCACCGATCCCGCACATGACATGTATCCACGA
CTCGTGGTGGCCGTCGTCCGCGCGGTGGGCGACGTCGCGATGGACCAGTACGCGAACGCCGATCCACCGGTGTCCTTCAC
CGAACTACTGCGTCAGGGGTTCGCGGCCGTCACCGCGGGACTGCCTGAACCCGAGAGGAAGAAATGA

>>MEG_7194|Drugs|Tetracyclines|Tetracycline_transcriptional_repressor|TETR|RequiresSNPConfirmation
ATGGCAAAGCTAGATAAAGAACAAGTTATTGATAATGCGTTGATTTTACTTAATGAAGTTGGTATTGAAGGATTAACAAC
GCGTAAGCTGGCGCAAAAAATAGGTGTGGAACAACCCACATTGTATTGGCATGTAAAAAATAAACGCGCTTTGTTAGATG
CATTAGCAGAAACTATTTTGCAAAAGCACCATCATCATGTTTTGCCATTGCCGAATGAAACATGGCAGGACTTTTTGCGA
AATAACGCGAAAAGCTTCCGCCAAGCCTTATTAATGTATCGTGATGGTGGCAAAATTCATGCGGGAACACGCCCCTCTGA
AAGTCAATTTGAGACATCAGAACAGCAACTACAGTTTTTGTGTGATGCTGGGTTTAGTCTATCTCAAGCCGTGTATGCAT
TAAGCTCTATTGCGCATTTTACATTAGGCTCCGTACTGGAAACTCAAGAGCATCAAGAAAGCCAAAAAGAGCGTGAAAAA
GTAGAGACGGATACTGTTGCCTATCCGCCATTATTAACCCAAGCCGTTGCAATTATGGATAGTGATAATGGTGATGCTGC
ATTTTTGTTTGTCCTTGATGTGATGATCTCTGGACTTGAAACAGTATTAAAGAGCGCTAAATAA

>>MEG_7195|Drugs|Tetracyclines|Tetracycline_transcriptional_repressor|TETR|RequiresSNPConfirmation
ATGAGTAAAAAAGATATTGCACCTCAACGTCTGACACGTGAAATAGTCCTGCGTACCGCATTGGATATGTTGAATGAAGA
AGGCATAGATTCAATAACCACACGCAAGCTAGCTCAACGATTGGGTATTAAATCTCCAACTCTATATTGGCATTTCAAGA
ATAAATCCTTGTTAATGGAAGCAATGGCGGAAACCATTATAAATGAACACCATTTAGTTTCTTTACCCATCGATGGGATG
ACATGGCAAGATTGGTTGCTCGCTAATTCTGTAAGCTTTCGTCGAGCACTACTAGCTTACCGTGATGGTGCTCGTCTACA
TGCAAGAACTAGCCCCAGTCAAGGACATTTCAACACGATTGAGGCCCAAGTTGCGCTGTTATCTCATGCTGGGTTTTCTC
CTGTTGAAGCAGTTGCATTACTTATGACATTAGGAAGGTTTATTGTTGGGTGGGTCCTTGAGGAGCAGCAAGAAGAAATA
AGATCAGACCCACCATTCGAAGCCGATCCAACTATATATCCACTCATGCTCCAAGGAGTGAATACCTTACAAAATATGAA
TGCGGATGACATTTTTGAAAATGGGATTCGTATGGTGATTATCGGTGCTGAAAGACAACTTGATATTAAAATGCAAACTT
AA