MEGAResFrom MEG, the Microbial Ecology Group

Notice: Trying to access array offset on value of type null in /home/meglabuser/megares.meglab.org/vendor/doctrine/annotations/lib/Doctrine/Common/Annotations/DocParser.php on line 967

TETS

The tetS gene encodes a tetracycline ribosomal protection protein.

References

  • http://aac.asm.org/content/47/12/3675

Notice: Trying to access array offset on value of type null in /home/meglabuser/megares.meglab.org/vendor/doctrine/annotations/lib/Doctrine/Common/Annotations/DocParser.php on line 967

Other Groups in Tetracycline resistance ribosomal protection proteins

Sequences

Download Sequences

>>MEG_7198|Drugs|Tetracyclines|Tetracycline_resistance_ribosomal_protection_proteins|TETS
ttgaaaattattaatatcggtatcttagcacatgttgatgcaggaaaaactactttgacagaaagcttactatacagtag
cggagcaattaaagagttaggaagtgtagatagcggtacaacgaaaacggatactatgtttttggaacgccagagaggta
ttactattcagaccgcaataacatcttttcaacgggaaaatgttaaagtaaatattgtagatactcctggacacatggat
tttttggcagatgtataccgttcattatctgttttggatggagctattttgctaatctctgcaaaagatggagtacagtc
acaaactcgtatactattccatgcacttagaaagatgaacatacctataatattttttattaacaaaattgatcaaaatg
gaataaatttgccagatgtttatcaagatattaaggacaaactttctgacgacatcataattaagcagactgtgaatcta
aatttgaaaccttatgtaatagattatactgaaccagaacaatgggagacagtaattgtgggaaatgattatttattaga
aaaatataccattgggaaaacattgaatattgcagaacttgaaaaggaggaaaacgaaagaattcaaagttgctccttat
atcctgtttatcacggaagtgcaaagaataatattggaattaaacaacttatagaggtaattactagcaaattattttca
cccacacaactcaattcagataaactttgtggaaatgtttttaaagtagaatattcagatgatggtcaacggcttgtcta
tgtacgtctttatagtggaacgctacatttgcgagactcagtcaatatatcagaaaaggaaaaaataaaagttacagaaa
tgtatacttcaataaatggagaattacgccagatagataaggcagagcctggtgagattattattttaaaaaatgagctt
ttaaaactaaataacgtacttggagataaaaaaagattaccacatagagaaattcttgagaatcctcttcctatgttaca
aacaacaattgaaccatgtaaatcagtacaaagagaaaagttactagatgcactttttgaaatatccgatagtgatcccc
ttctacaatattatgtagatacagtaactcacgaaattgtgctatcttttttaggtgaggtccaaatggaggtaacttgt
actctgattcaagaaaaatatcatattgagatagaaacaagaaaaccaactgtcatttatatggaaagaccattaaaaaa
atctgaatttaccattgatatcgaagtacctccaaatcctttctgggcttctattggtttatctgtaacaccacttcctt
tgggtagtggcattcagtatgagagcctggtttctctaggttatttaaatcaatcatttcaaaatgcagttatggaaggt
atacgctatgggtgtgaacaaggattgtacggttggaaattaacagactgtaagatctgttttaagtatggtctatatta
cagccctgtcagtacgccagcagatttccgaatgcttgcgcctattgtactagagcaggcttttagaaagagtggtacag
agttattagagccatatcttagcttcgaaatttatgtaccacaagaatatctttcgagagcatataatgatgcttccaaa
tattgtgcaaatattttaaatactaagttaaaaggtaacgaggtcattctcattggtgaaatccctgctcggtgtattca
agaatatcgtagtgatttaactttctttacaaatggacgtagtgtttgtttaacagagttaaaagggtaccatgttacta
ccggtgaacctgtttgccagccccgtcgtccaaatagtcggatagataaagtacgatatatgttcaataaaataacttag

>>MEG_7199|Drugs|Tetracyclines|Tetracycline_resistance_ribosomal_protection_proteins|TETS
TTGAAAATTATTAATATCGGTATCTTAGCACATGTTGATGCAGGAAAAACTACTTTGACAGAAAGCTTACTATACAGTAG
CGGAGCAATTAAAGAGTTAGGAAGTGTAGATAGCGGTACAACGAAAACGGATACTATGTTTTTGGAACGCCAGAGAGGTA
TTACTATTCAGACCGCAATAACATCTTTTCAACGGGAAAATGTTAAAGTAAATATTGTAGATACTCCTGGACACATGGAT
TTTTTGGCAGATGTATACCGTTCATTATCTGTTTTGGATGGAGCTATTTTGCTAATCTCTGCAAAAGATGGAGTACAGTC
ACAAACTCGTATACTATTCCATGCACTTAGAAAGATGAACATACCTATAATATTTTTTATTAACAAAATTGATCAAAATG
GAATAAATTTGCCAGATGTTTATCAAGATATTAAGGACAAACTTTCTGACGACATCATAATTAAGCAGACTGTGAATCTA
AATTTGAAACCTTATGTAATAGATTATACTGAACCAGAACAATGGGAGACAGTAATTGTGGGAAATGATTATTTATTAGA
AAAATATACCATTGGGAAAACATTGAATATTGCAGAACTTGAAAAGGAGGAAAACGAAAGAATTCAAAGTTGCTCCTTAT
ATCCTGTTTATCACGGAAGTGCAAAGAATAATATTGGAATTAAACAACTTATAGAGGTAATTACTAGCAAATTATTTTCA
CCCACACAACTCAATTCAGATAAACTTTGTGGAAATGTTTTTAAAGTAGAATATTCAGATGATGGTCAACGGCTTGTCTA
TGTACGTCTTTATAGTGGAACGCTACATTTGCGAGACTCAGTCAATATATCAGAAAAGGAAAAAATAAAAGTTACAGAAA
TGTATACTTCAATAAATGGAGAATTACGCCAGATAGATAAGGCAGAGCCTGGTGAGATTATTATTTTAAAAAATGAGCTT
TTAAAACTAAATAACGTACTTGGAGATAAAAAAAGATTACCACATAGAGAAATTCTTGAGAATCCTCTTCCTATGTTACA
AACAACAATTGAACCATGTAAATCAGTACAAAGAGAAAAGTTACTAGATGCACTTTTTGAAATATCCGATAGTGATCCCC
TTCTACAATATTATGTAGATACAGTAACTCACGAAATTGTGCTATCTTTTTTAGGTGAGGTCCAAATGGAGGTAACTTGT
ACTCTGATTCAAGAAAAATATCATATTGAGATAGAAACAAGAAAACCAACTGTCATTTATATGGAAAGACCATTAAAAAA
ATCTGAATTTACCATTGATATCGAAGTACCTCCAAATCCTTTCTGGGCTTCTATTGGTTTATCTGTAACACCACTTCCTT
TGGGTAGTGGCATTCAGTATGAGAGCCTGGTTTCTCTAGGTTATTTAAATCAATCATTTCAAAATGCAGTTATGGAAGGT
ATACGCTATGGGTGTGAACAAGGATTGTACGGTTGGAAATTAACAGACTGTAAGATCTGTTTTAAGTATGGTCTATATTA
CAGCCCTGTCAGTACGCCAGCAGATTTCCGAATGCTTGCGCCTATTGTACTAGAGCAGGCTTTTAGAAAGAGTGGTACAG
AGTTATTAGAGCCATATCTTAGCTTCGAAATTTATGTACCACAAGAATATCTTTCGAGAGCATATAATGATGCTTCCAAA
TATTGTGCAAATATTTTAAATACTAAGTTAAAAGGTAACGAGGTCATTCTCATTGGTGAAATTCCAGCCCGTTGTATTCA
AGAGTATCGAAACAGTTTAACTTTCTTTACAAATGGACGCAGTGTCTGTTTAACAGAGTTAAAAGGTTATCAGGTTACTA
ACATTAAGTCTGCTTTCCAACCACGTCGTCCAAATAATAGAATAGACAAAGTAAGGCATATGTTTAATAAAATCAACTTA
CATTGA

>>MEG_7200|Drugs|Tetracyclines|Tetracycline_resistance_ribosomal_protection_proteins|TETS
TCAATGTAAGTTGATTTTATTAAACATATGCCTTACTTTGTCTATTCTATTATTTGGACGACGTGGTTGGAAAGCAGACT
TAATGTTAGTAACCTGATAACCTTTTAACTCTGTTAAACAGACACTGCGTCCATTTGTAAAGAAAGTTAAACTGTTTCGA
TACTCTTGAATACAACGGGCTGGAATTTCACCAATGAGAATGACCTCGTTACCTTTTAACTTAGTATTTAAAATATTTGC
ACAATATTTGGAAGCATCATTATATGCTCTCGAAAGATATTCTTGTGGTACATAAATTTCGAAGCTAAGATATGGCTCTA
ATAACTCTGTACCACTCTTTCTAAAAGCCTGCTCTAGTACAATAGGCGCAAGCATTCGGAAATCTGCTGGCGTACTGACA
GGGCTGTAATATAGACCATACTTAAAACAGATCTTACAGTCTGTTAATTTCCAACCGTACAATCCTTGTTCACACCCATA
GCGTATACCTTCCATAACTGCATTTTGAAATGATTGATTTAAATAACCTAGAGAAACCAGGCTCTCATACTGAATGCCAC
TACCCAAAGGAAGTGGTGTTACAGATAAACCAATAGAAGCCCAGAAAGGATTTGGAGGTACTTCGATATCAATGGTAAAT
TCAGATTTTTTTAATGGTCTTTCCATATAAATGACAGTTGGTTTTCTTGTTTCTATCTCAATATGATATTTTTCTTGAAT
CAGAGTACAAGTTACCTCCATTTGGACCTCACCTAAAAAAGATAGCACAATTTCGTGAGTTACTGTATCTACATAATATT
GTAGAAGGGGATCACTATCGGATATTTCAAAAAGTGCATCTAGTAACTTTTCTCTTTGTACTGATTTACATGGTTCAATT
GTTGTTTGTAACATAGGAAGAGGATTCTCAAGAATTTCTCTATGTGGTAATCTTTTTTTATCTCCAAGTACGTTATTTAG
TTTTAAAAGCTCATTTTTTAAAATAATAATCTCACCAGGCTCTGCCTTATCTATCTGGCGTAATTCTCCATTTATTGAAG
TATACATTTCTGTAACTTTTATTTTTTCCTTTTCTGATATATTGACTGAGTCTCGCAAATGTAGCGTTCCACTATAAAGA
CGTACATAGACAAGCCGTTGACCATCATCTGAATATTCTACTTTAAAAACATTTCCACAAAGTTTATCTGAATTGAGTTG
TGTGGGTGAAAATAATTTGCTAGTAATTACCTCTATAAGTTGTTTAATTCCAATATTATTCTTTGCACTTCCGTGATAAA
CAGGATATAAGGAGCAACTTTGAATTCTTTCGTTTTCCTCCTTTTCAAGTTCTGCAATATTCAATGTTTTCCCAATGGTA
TATTTTTCTAATAAATAATCATTTCCCACAATTACTGTCTCCCATTGTTCTGGTTCAGTATAATCTATTACATAAGGTTT
CAAATTTAGATTCACAGTCTGCTTAATTATGATGTCGTCAGAAAGTTTGTCCTTAATATCTTGATAAACATCTGGCAAAT
TTATTCCATTTTGATCAATTTTGTTAATAAAAAATATTATAGGTATGTTCATCTTTCTAAGTGCATGGAATAGTATACGA
GTTTGTGACTGTACTCCATCTTTTGCAGAGATTAGCAAAATAGCTCCATCCAAAACAGATAATGAACGGTATACATCTGC
CAAAAAATCCATGTGTCCAGGAGTATCTACAATATTTACTTTAACATTTTCCCGTTGAAAAGATGTTATTGCGGTCTGAA
TAGTAATACCTCTCTGGCGTTCCAAAAACATAGTATCCGTTTTCGTTGTACCGCTATCTACACTTCCTAACTCTTTAATT
CGTCCGCTACTGTATAGTAAGCTTTCTGTCAAAGTAGTTTTTCCTGCATCAACATGTGCTAAGATACCGATATTAATAAT
TTTCAATTTTATTTCCTCCAT

>>MEG_7201|Drugs|Tetracyclines|Tetracycline_resistance_ribosomal_protection_proteins|TETS
TTGAAAATTATTAATATCGGTATCTTAGCACATGTTGATGCAGGAAAAACTACTTTGACAGAAAGCTTACTATACAGTAG
CGGACGAATTAAAGAGTTAGGAAGTGTAGATAGCGGTACAACGAAAACGGATACTATGTTTTTGGAACGCCAGAGAGGTA
TTACTATTCAGACCGCAATAACATCTTTTCAACGGGAAAATGTTAAAGTAAATATTGTAGATACTCCTGGACACATGGAT
TTTTTGGCAGATGTATACCGTTCATTATCTGTTTTGGATGGAGCTATTTTGCTAATCTCTGCAAAAGATGGAGTACAGTC
ACAAACTCGTATACTATTCCATGCACTTAGAAAGATGAACATACCTATAATATTTTTTATTAACAAAATTGATCAAAATG
GAATAAATTTGCCAGATGTTTATCAAGATATTAAGGACAAACTTTCTGACGACATCATAATTAAGCAGACTGTGAATCTA
AATTTGAAACCTTATGTAATAGATTATACTGAACCAGAACAATGGGAGACAGTAATTGTGGGAAATGATTATTTATTAGA
AAAATATACCATTGGGAAAACATTGAATATTGCAGAACTTGAAAAGGAGGAAAACGAAAGAATTCAAAGTTGCTCCTTAT
ATCCTGTTTATCACGGAAGTGCAAAGAATAATATTGGAATTAAACAACTTATAGAGGTAATTACTAGCAAATTATTTTCA
CCCACACAACTCAATTCAGATAAACTTTGTGGAAATGTTTTTAAAGTAGAATATTCAGATGATGGTCAACGGCTTGTCTA
TGTACGTCTTTATAGTGGAACGCTACATTTGCGAGACTCAGTCAATATATCAGAAAAGGAAAAAATAAAAGTTACAGAAA
TGTATACTTCAATAAATGGAGAATTACGCCAGATAGATAAGGCAGAGCCTGGTGAGATTATTATTTTAAAAAATGAGCTT
TTAAAACTAAATAACGTACTTGGAGATAAAAAAAGATTACCACATAGAGAAATTCTTGAGAATCCTCTTCCTATGTTACA
AACAACAATTGAACCATGTAAATCAGTACAAAGAGAAAAGTTACTAGATGCACTTTTTGAAATATCCGATAGTGATCCCC
TTCTACAATATTATGTAGATACAGTAACTCACGAAATTGTGCTATCTTTTTTAGGTGAGGTCCAAATGGAGGTAACTTGT
ACTCTGATTCAAGAAAAATATCATATTGAGATAGAAACAAGAAAACCAACTGTCATTTATATGGAAAGACCATTAAAAAA
ATCTGAATTTACCATTGATATCGAAGTACCTCCAAATCCTTTCTGGGCTTCTATTGGTTTATCTGTAACACCACTTCCTT
TGGGTAGTGGCATTCAGTATGAGAGCCTGGTTTCTCTAGGTTATTTAAATCAATCATTTCAAAATGCAGTTATGGAAGGT
ATACGCTATGGGTGTGAACAAGGATTGTACGGTTGGAAATTAACAGACTGTAAGATCTGTTTTAAGTATGGTCTATATTA
CAGCCCTGTCAGTACGCCAGCAGATTTCCGAATGCTTGCGCCTATTGTACTAGAGCAGGCTTTTAGAAAGAGTGGTACAG
AGTTATTAGAGCCATATCTTAGCTTCGAAATTTATGTACCACAAGAATATCTTTCGAGAGCATATAATGATGCTTCCAAA
TATTGTGCAAATATTTTAAATACTAAGTTAAAAGGTAACGAGGTCATTCTCATTGGTGAAATTCCAGCCCGTTGTATTCA
AGAGTATCGAAACAGTTTAACTTTCTTTACAAATGGACGCAGTGTCTGTTTAACAGAGTTAAAAGGTTATCAGGTTACTA
ACATTAAGTCTGCTTTCCAACCACGTCGTCCAAATAATAGAATAGACAAAGTAAGGCATATGTTTAATAAAATCAACTTA
CATTGA