MEGAResFrom MEG, the Microbial Ecology Group

Notice: Trying to access array offset on value of type null in /home/meglabuser/megares.meglab.org/vendor/doctrine/annotations/lib/Doctrine/Common/Annotations/DocParser.php on line 967

OTRA

The otrA gene encodes a tetracycline ribosomal protection protein.

References

  • http://aac.asm.org/content/47/12/3675

Notice: Trying to access array offset on value of type null in /home/meglabuser/megares.meglab.org/vendor/doctrine/annotations/lib/Doctrine/Common/Annotations/DocParser.php on line 967

Other Groups in Tetracycline resistance ribosomal protection proteins

Sequences

Download Sequences

>>MEG_4378|Drugs|Tetracyclines|Tetracycline_resistance_ribosomal_protection_proteins|OTRA
atgcgcaccctgaacatcggcattctggcccacgtcgacgcgggtaagaccagcctgaccgaacggctcctgttcgacca
cggcgccgtcgaccggctcggcagcgtcgacgccggcgacacccgtacggtcgacggcggtatcgagcgccgccgcggca
tcaccatccgctccgccgtcgccgccttcaccgtcggcgacacgcgcgtcaacctgatcgacaccccgggacactccgac
ttcgtcgcggaggtcgagcgggccctggaagtgctcgacggggcggtgctgctgctgtccgccgtcgagggcgtccaggc
gcggacccgcgtcctgatgcgcgcgctgcggcggctgcggctgcccacgatcgtgttcgtcaacaagatcgaccgggccg
gcgcgcgcaccgacggcctcctcggtgacgtccggcgcctgctgacgccgcacgtcgcgccgctgaccgaggtggcggac
gccggtaccccgcgcgcccgggtcacccgccgcccgccggacgggcggaccgcggaggccctcgccgaggtcgacacgga
ggtcctggccgcgctggtcgacggccccgagccgaccggggaggacgtggcccgcgccctcgccgcccgtaccgccgacg
gctcgttccacccgctgtaccacggctccgcgctcggcggacagggcgtcgcggagctggtcgagggcctgctcggcctg
atcccggccgccacgccgggcacgtccggcggcacgtccggcggcacggaaccgcgcggcacggtcttcgccgtgcgccc
cggacccgccggcgagcgcaccgcgtacctcaggctgtacggcggcgaggtgcacccgcgccggcggctcaccttcctgc
ggcgcgagtccgacgggcggaccaccgaggtctccggccgggtgacccgcctcgacgtcgtcggcggcgacgccacgctc
accgccgggaacatcgccgcgctcaccgttcccgggggcctgcgcgtcggcgaccggctcggcggaccgaccgaccgtgc
accgcagttcgcgccaccgaccctgcagacgctggtccgggcccggcacccggagcaggcggcgccgctgcgctccgccc
tgctggcgctggccgaccaggacccgctgctgcacgcccgaccggcggcgtccggcgccaccgccctgctcctgtacggc
gaggtccagatggaggtgctcgcggcgacactggccgaggacttcgggatcgaggcggagttcacgccgggccgcgtccg
gttcctggagcgtccggcgggcaccgacgaggccgcggaggagatgccgtggctcgaccgcacccggtacttcgcgacga
tcgggctgcgcgtcgaaccgggtccgcgcggctccggcggggccttcgggtacgagacggagctcggcgcgctcccccgg
gccttccaccaggccgtcgaggagaccgtccacgacacgctgcggaccgggctcaccggtgcggcggtcaccgactaccg
ggtcacgctgatccgctccggcttcagctcgccgctcagcacggccgccgacttccgcgggctgacaccgctcgtgctgc
gccgtgccctcgcccgcgcggggaccgtgctccacgagccgtaccaggccttcgaggcggaggtcccggcggacacgctg
gccgccgtgacggccctgctggcctcgctgggcgcggacttcaccggaacgacggggggcgacccggcctggatcgtcac
cggcgagctgccggcccggcgggtgcgggaggccgagctgcggctgccggggctgacgcacggggaggcggtctggtcct
cccgcccttgcgaggaccgaccgctgaaggccggaaactctgggcctggcacgggagttggcgggcattcgggtgagtag

>>MEG_4379|Drugs|Tetracyclines|Tetracycline_resistance_ribosomal_protection_proteins|OTRA
ATGAACAAGCTGAATCTGGGCATCCTGGCCCACGTTGACGCCGGCAAGACCAGCCTCACCGAGCGCCTGCTGCACCGCAC
CGGTGTGATCGACGAGGTCGGCAGCGTGGACGCCGGCACCACGACGACCGACTCGATGGAGCTGGAGCGGCAGCGCGGCA
TCACCATCCGGTCCGCCGTGGCCACGTTCGTCCTGGACGATCTCAAGGTCAACCTCATCGACACCCCGGGCCACTCCGAC
TTCATCTCCGAGGTCGAGCGGGCGCTCGGGGTGCTCGACGGCGCGGTCCTGGTGGTCTCGGCCGTCGAGGGCGTCCAGCC
GCAGACCCGCATCCTGATGCGGACCCTGCGCAGGCTGGGCATTCCCACGCTGGTCTTCGTCAACAAGATCGACCGGGGCG
GCGCGCGTCCCGACGGTGTGCTGCGGGAGATCCGCGACCGGCTCACCCCCGCCGCGGTGGCACTGTCCGCCGTGGCGGAC
GCCGGCACGCCGCGGGCCCGCGCGATCGCGCTCGGCCCGGACACCGACCCGGACTTCGCCGTCCGGGTCGGTGAGCTGCT
GGCCGACCACGACGACGCGTTCCTCACCGCCTACCTGGACGAGGAACACGTACTGACCGAGAAGGAGTACGCGGAGGAAC
TGGCCGCGCAGACCGCGCGCGGTCTGGTGCACCCGGTGTACTTCGGGTCCGCGCTGACCGGCGAGGGCCTGGACCATCTG
GTGCACGGCATCCGGGAGTTGCTGCCGTCCGTGCACGCGTCGCAGGACGCGCCGCTGCGGGCCACCGTGTTCAAGGTGGA
CCGTGGCGCGCGCGGCGAGGCCGTCGCGTACCTGCGGCTGGTCTCCGGCACGCTGGGCACCCGCGATTCGGTGACGCTGC
ACCGCGTCGACCACACCGGCCGGGTCACCGAGCACGCCGGACGCATCACCGCGCTGCGGGTCTTCGAGCACGGGTCGGCC
ACCAGCGAGACCCGGGCGACCGCCGGGGACATCGCGCAGGCGTGGGGCCTGAAGGACGTACGGGTCGGTGACCGGGCCGG
GCACCTCGACGGTCCCCCGCCGCGCAACTTCTTCGCGCCGCCCAGCCTGGAGACCGTGATCAGGCCGGAGCGCCCGGAGG
AAGCGGGACGGCTGCACGCCGCGCTGCGCATGCTGGACGAGCAGGACCCCTCGATCGACCTGCGGCAGGACGAGGAGAAC
GCGGCCGGCGCGGTGGTCCGCCTCTACGGGGAGGTGCAGAAGGAGATCCTCGGCAGCACGCTCGCGGAGTCCTTCGGCGT
ACGGGTGCGCTTCGACCCGACCCGTACGGTCTGCATCGAAAAGCCCGTGGGGACCGGCGAGGCGCTGATCGAGCTGGACA
CGCGGACGCACAACTACTTCTGGGGCGCACCGTGGGTCTGCGCGTCGGACCGGCCGAGCCCGGCGCGGGCGATCACGTTC
CGTTTGGCGGTGGAACTGGGCTCGCTCCCCCTGGCCTTCCACAAGGCCATCGAGGAGACGGTGCACACCACCCTGCGGCA
CGGTCTGTACGGCTGGCAGGTCACCGACTGCGCCGTCACCCTGACCCGTACCGGCGTTCGCAGTCCGGTCAGCGCGGCCG
ACGACTTCCGCAAGGCCAACGCGCGCTTGGTCCTGATGGACGCGCTCGGCAGGGCCGGTACGGAGGTGCACGAGCCGGTC
AGCTCCTTCGAACTGGAGGTGCCCGCCGCCCGGCTCAGCCCGGTACTTGCGAAACTCGCGGAACTGGGCGCGACGCCCGG
TGTGCCCACGGCCGAGGGGGACGTCTTCCGCCTGGAGGGCACGATGCCGACCAGCCTCGTGCACGACTTCAACCAGCGGG
TTCCCGGACTGACCCAGGGCGAGGGCGTGTTCCTGGCCGAGCACCGGGGCTACCGGCCCGCCGTCGGACAGCCGCCCGTG
CGGCCGCGGCCCGAGGGGCCCAACCCGCTCAACCGCGACGAGTACATCCTGCACGTGCTCAAGCGCGTGTGA