MEGAResFrom MEG, the Microbial Ecology Group

Notice: Trying to access array offset on value of type null in /home/meglabuser/megares.meglab.org/vendor/doctrine/annotations/lib/Doctrine/Common/Annotations/DocParser.php on line 967

TETJ

The tetJ gene encodes a tetracycline efflux pump.

References

  • http://www.ncbi.nlm.nih.gov/pubmed/8534971

Notice: Trying to access array offset on value of type null in /home/meglabuser/megares.meglab.org/vendor/doctrine/annotations/lib/Doctrine/Common/Annotations/DocParser.php on line 967

Other Groups in Tetracycline resistance MFS efflux pumps

Sequences

Download Sequences

>>MEG_7087|Drugs|Tetracyclines|Tetracycline_resistance_MFS_efflux_pumps|TETJ
ATGAATAAATCAATTATTATCATACTGCTTGTCACAGTATTAGATGCCATTGGTATTGGCCTTATCATGCCAGTACTACC
AACACTATTAAACGAGTTTGTGAGCGAAAACAGACTCGCCAATCATTACGGTATATTATTAGCACTCTATGCGACGATGC
AGGTGATCTTCGCACCTATTTTAGGAAAATTATCAGATAAATATGGCAGAAAACCTATTTTATTAATTTCGCTATTGGGT
GCCGCATTAGATTACCTATTAATGGCTTGCCCCACCTCATTATGGATGCTCTACATTGGACGAATAATTGCGGGTATAAC
AGGAGCCACTGGTGCAGTATGCGCATCAGCAATGACTGATGTAACTCATCCTCATGAAAGAACACGCTATTTCGGTTTTT
TGGGTGGTGCATTTGGTGTGGGTTTAATTATTGGCCCCATGTTAGGGGGATTACTCGGTGAGATCAGCGCCCATACGCCA
TTTATCTTTGCGGCTATTTCTCATTCGTTATTATTTATATTTTCATTACTTTGTTTCCAAGAAACTCAAACCACAAAAAT
TTCGACTGAAATATCCGCATTAAATCAGGATACAGCGCCTCACTCTACCACTGGTTTTATTAAAAAGAGTCTCTTTTTTT
GGCTTATTGCCTATTTTATTATTCAACTAATAGGGCAAATTCCGGCCACTATTTGGGTGCTATTCACACAAGTTCGTTTC
GCTTGGCACACTACTGAAGTAGGTTTATCTCTTGCATTTCTTGGTGTATTACATATTTTTTTTCAAGCGGTTCTCGCAGG
AAAACTGGCGCAAAAATGGGGAGAACGCAACACGGTTATCATTAGCATGTCAATTGATGCATTTGGTTGCTTATTATTAG
CCTGGATAAGCCATGTTTGGGTTATGCTTCCCGCTTTAATCTGTTTAGCTGCGGGAGGAATGGGACAACCTGCTTTACAA
GGATATTTATCAAAATCTGTTGATCATCATGTTCAAGGACAGTTACAAGGAACGTTAGTCAGTCTAACGAATATAACTGG
GATTGTCGGCCCGTTACTCTTCTCTTTTATTTATAGTTACAGCGTTGAATATTGGGATGGCTTATTGTGGTTTATTGGTG
CAATGCTTTACAGTGGGTTACTTGTAGCCAGTTATTTTAAACAGAAATCACCAATATTAAAAAAATTTCCCTCATAA

>>MEG_7088|Drugs|Tetracyclines|Tetracycline_resistance_MFS_efflux_pumps|TETJ
ATGAATAAATCAATTATTATCATACTGCTTGTCACAGTATTAGATGCCATTGGTATTGGCCTTATCATGCCAGTACTACC
AACACTATTAAACGAGTTTGTGAGCGAAAACAGACTCGCCAATCATTACGGTATATTATTAGCACTCTATGCGACGATGC
AGGTGATCTTCGCACCTATTTTAGGAAAATTATCAGATAAATATGGCAGAAAACCTATTTTATTATTTTCGCTATTGGGT
GCGGCATTAGATTACCTATTAATGGCTTGCTCTACCTCATTATGGATGCTCTACATTGGACGCATTATTGCGGGTATAAC
AGGAGCCACTGGTGCAGTATGCGCATCAGCAATGACTGATGTTACTCACCCTCATGAAAGAACACGCTATTTCGGTTTTT
TGGGTGGTGCATTTGGTGTGGGTTTAATTATTGGCCCCATGTTAGGGGGATTACTGGGTGAGATCAGCGCCCATACGCCA
TTTATCTTTGCGGCTATTTCTCATTCGTTATTATTTATATTTTCATTACTTTGTTTCCAAGAAACTCAAACCACAAAAAT
ATCGACTGAAATATCCGCATTAAATCAGGATACAGCACCTCACTCTGCCACTGGTTTTATTAAAAAGAGTCTCTGTTTTT
GGCTTATTGCCTATTTTATTATTCAACTAATAGGGCAAATTCCGGCCACTATTTGGGTGCTATTCACACAAGTGCGTTTC
GCTTGGCACACTACTGAAGTAGGTTTATCTCTTGCATTTCTTGGTGTATTACATATTTTTTTTCAAGCGGTTCTCGCAGG
AAAACTGGCGCAAAAATGGGGAGAACGCAACACGGTTATCATTAGCATGTCTATTGATGCATTTGGTTGCTTATTATTAG
CCTGGATAAGCCATGTTTGGGTTATGCTCCCCGCTTTAATCTGTTTAGCTGCGGGAGGAATGGGACAACCTGCTTTACAA
GGATATTTATCAAAATCTGTTGATCATCATGTTCAAGGACAATTACAAGGAACGTTAGTAAGTCTAACGAATATAACTGG
GATTGTCGGCCCGTTACTCTTCTCTTTTATTTATAGTTACAGCGTTGAATATTGGGATGGCTTATTGTGGTTTATTGGTG
CAATGCTTTACAGTGGATTACTTGTAGCCAGTTATTTTAAACAGAAATCACCAATATTAAAAAAATTTCCCTCATAA