Warning: "continue" targeting switch is equivalent to "break". Did you mean to use "continue 2"? in /home/meglabuser/megares.meglab.org/vendor/doctrine/orm/lib/Doctrine/ORM/UnitOfWork.php on line 2640
MEGARes
MEGAResFrom MEG, the Microbial Ecology Group

Notice: Trying to access array offset on value of type null in /home/meglabuser/megares.meglab.org/vendor/doctrine/annotations/lib/Doctrine/Common/Annotations/DocParser.php on line 967

TET35

The tet35 gene encodes a tetracycline efflux pump.

References

  • http://www.ncbi.nlm.nih.gov/pubmed/8534971

Deprecated: The behavior of unparenthesized expressions containing both '.' and '+'/'-' will change in PHP 8: '+'/'-' will take a higher precedence in /home/meglabuser/megares.meglab.org/src/Sequence.php on line 169

Notice: Trying to access array offset on value of type null in /home/meglabuser/megares.meglab.org/vendor/doctrine/annotations/lib/Doctrine/Common/Annotations/DocParser.php on line 967

Other Groups in Tetracycline resistance MFS efflux pumps

Sequences

Download Sequences

>>MEG_6977|Drugs|Tetracyclines|Tetracycline_resistance_MFS_efflux_pumps|TET35
atgaatttaatagatttttctcattctcctgtttcattattgcctcctattgttgctctgacattggcgattctgactcg
acgtgtattagtttctcttggtgtaggtatcgcgcttggtgcggttctacttaacagctggtcaattggtggtactgcaa
gctatgtaggtactcaagtgtcttctgtcttcattgaagatggtggaattaacacttggaacatgagcattgttggtttc
ctaattctattaggcatgacaacggctctattgacactttctggcggtactcgcgcattcgctgaatgggcacagtctcg
tgtgaaaagtaaacgcggctctaaacttcttgcagcctttttaggcgtattcatttttgtcgacgattactttaatagtc
ttgctgtaggtgcgatttcacgcccagtaacggatcgcttctatgtatctcgtgcgaaactggcttacatcctagattca
accgctgcacctatgtgtgtcatcatgcctgcttctagttggggtgcttacatcatcactatcatcggcggtattttagt
atcacacggtattactgagtattcagcgcttggggcgtatgtgcgtcttatcccaatgaacttctacgctgtatttgcgc
tgttaatggtgtttgcagtagcgtggtttggtctggatatcggtaagatgcgcgagcatgaaattgcagcgtctcaaggt
cgtggttttgacaaagacaaagagaacgacactcaagaagcgcatgagcttaacgaagagttggacattcgtgagagcga
aaaaggtaaagtctctgacttaatcctaccgattgttacgcttatcatcgcgacaattgcttcgatgatgtacaccggtg
gtcaagcgttggctgctgacggtaaagagtttgcattgttaggtgcattcgagaataccgatgtgggtacgtctctgatt
tacggtagcttgcttggtttggccgttgctctgtttactgttctaaaacaaggtctaccactgactgagattactcgtac
actgtggattggtgctaaatcgatgtttggtgcgattcttatccttgtgtttgcgtggacaatcggttctgttatcggtg
acatgaagacgggttcgtacctatcgactatggctcaaggtaacattaatccgcattggttacctgtaatcctgttcttg
ttgtcgggtctaatggcgttctcaaccggtacttcatggggtacattcggtatcatgttaccaatcgccggtgatatggc
gggtgcaactgacatcgcactaatgcttcctatgctaagtgcagttttggccggtgcagtattcggtgaccactgttcac
caatctcggacacgactattttgtcttcgacaggtgctcgttgtaatcacatcgaccacgtatcgactcagttgccttat
gcgctgtcagttgctttggtttcatgtgtcggctttattgcacttggtatgacaacgtcaatcgcgttctctttcattgc
agcatcgattacatttgttatcgtctgtgctgttctatcatggttgtcgaaatcgaaaatagaatcatgtcagagcgctt
aa

>>MEG_6978|Drugs|Tetracyclines|Tetracycline_resistance_MFS_efflux_pumps|TET35
ATGTGTGTGATCATGCCAGCTTCTAGTTGGGGTGCGTACATCATTACCATCATCGGTGGTATCTTGGTGTCACACGGCAT
CACTGAATACTCGGCGCTTGGTGCTTACGTTCGTCTTATTCCTATGAACTTCTACGCAGTATTTGCTCTACTAATGGTAT
TTGCAGTGGCGTGGTTTGGTCTAGATATCGGTAAGATGCGTGAACATGAAATCGCAGCATCTCAAGGCCGTGGTTTTGAT
AAAGATAAAGAGAACGACTCACAAGAAGCACACGACCTAAACGAAGAGCTAGATATTCGTGAAAGCGAGAAGGGTAAGGT
TTCTGACCTAATTCTTCCTATCGTAACGCTTATTGTGGCGACTATTGCTTCAATGCTTTACACCGGTGGTCAAGCGCTAG
CAGCAGATGGTAAAGAATTTGTGCTGTTGGGTGCGTTTGAAAACACGGATGTTGGTACTTCTCTAATCTACGGTAGTTTA
CTTGGTCTAGCAGTTGCATTGTTCACTGTTATTAAGCAAGGTCTACCAATGGTTGAGATTGCACGCACGCTTTGGATTGG
TGCTAAGTCAATGTTTGGTGCAATCCTTATCCTTGTTTTCGCTTGGACTATTGGTTCAGTTATCGGTGACATGAAGACGG
GTTCTTACCTATCTACAATGGCGCAAGGCAACATCAACCCACACTGGCTACCAGTTATCCTGTTCTTGCTGTCTGGCCTA
ATGGCGTTCTCTACAGGTACGTCATGGGGTACGTTCGGTATCATGCTTCCAATCGCGGGTGACATGGCTGGCGCAACAGA
CGTGGCACTAATGCTACCAATGCTAAGTGCGGTTCTAGCTGGTGCAGTATTTGGTGACCACTGTTCACCAATTTCAGATA
CAACGATTCTGTCGTCAACAGGTGCACGCTGTAACCACATCGATCACGTATCGACGCAGCTACCTTATGCATTATCAGTG
GCGTTTGTGTCATGTATTGGCTTTATCACGCTGGGTATGACTGCATCGATCGCGTTCTCTTTCATCGCAGCATCGATCAC
TTTCGTTATCGTTTGTGCGATTCTGTCGTGGCTGTCGAAGTCTAAAATGGCATCCTGCCAGAACGCGTAG