MEGAResFrom MEG, the Microbial Ecology Group

Notice: Trying to access array offset on value of type null in /home/meglabuser/megares.meglab.org/vendor/doctrine/annotations/lib/Doctrine/Common/Annotations/DocParser.php on line 967

TET30

The tet30 gene encodes a tetracycline efflux pump.

References


    Notice: Trying to access array offset on value of type null in /home/meglabuser/megares.meglab.org/vendor/doctrine/annotations/lib/Doctrine/Common/Annotations/DocParser.php on line 967

    Other Groups in Tetracycline resistance MFS efflux pumps

    Sequences

    Download Sequences

    >>MEG_6965|Drugs|Tetracyclines|Tetracycline_resistance_MFS_efflux_pumps|TET30
    ATGAACAAGGCCCTTATCGTTATTCTCTCAACCGTTGCCCTCGACGCCATTGGCGCAGGCCTGATCTTCCCGATCCTGCC
    GGACATCTTGGTCGAGGTGACTGGCGGCGGCGACATCGGGTTCCTCTATGGGGTCATGCTGGGGGTATTCGCCGTCATGC
    AATTTGTGTTCTCGCCGATCCTTGGTGCGCTCAGCGACCGGTTCGGTCGGCGCCCGGTCTTGTTGCTTTCTTTGGCCGGT
    ACCCTGCTTGATTACCTTGTTATGGCATTTTCCCCGCTCGGCTGGGTGCTCGTCGTCGGGCGGGCCATGGCGGGGATCAC
    CAGCGCAAATATGGCGGTGGCAAGCGCCTACATCACTGACATCACCCCAGCCGAGCAGCGCGCGCAGCGGTTTGGCACGG
    TTGGTGCCGTGATGAGCCTGGGCTTTATCATCGGTCCCGTCATTGGTGGCGTCATTGGCGCCTGGTGGCTTCGGGCACCA
    TTTCTTGTGGCAGCCCTGTTCAATGGCCTCAACCTGTTCGTCGCGCTGTTTGTTCTGCCGGAAAGCCGAAAGGCCGGTCC
    GGGCAAGTTTGCGTTCAAGGAACTTAACCCGTTGGCGCCATTGGTGTGGCTTTGGAATTTCAAGCCGCTCCTGCCACTTG
    TAACCGTCTCTGTCGTCTTCGGTCTGGTGGCCGCCATCCCGGGAACGATCTGGGTGCTCTATGGCGCCGAGCGGTTCGGA
    TGGGATTCGGTGCATATGGGCCTGTCGCTATCGGTTTTCGGCGTCAGTGGCGCCCTGGCGCAGGCCTTTCTCGTCGGGCC
    GCTCTCGCGCCGCTTTGGTGATTTGGGCACGTTGATGATCGGCGTTGGCTTTGACATGCTGGCTTATATGCTGATGGCCT
    TCGCCAACCAGAGCTGGATGGGCTACGCGGTAGCGCCCCTGTTTGCATTGGGCGGCGTTGCCATGCCGGCGCTGCAATCT
    CTGGTAACCAGCCGCGTGAGCGATGATCAGCAGGGCCAGTTGCAGGGCGTGCTCGCCAGCCTCATGAGCCTGGCGGGTAT
    AATAGGGCCGGTGCTGACCACCGCAGTGTTCTTTTCCACCAAAAGCATCTGGATCGGGACGATCTGGCTGGTGGGTGCCG
    CACTTTATCTTCTCGCCTTGCCGCTGTTCGCAACGGTGAAAACCCCGAAGGCTGTGGCGGCTTAA