MEGAResFrom MEG, the Microbial Ecology Group

Notice: Trying to access array offset on value of type null in /home/meglabuser/megares.meglab.org/vendor/doctrine/annotations/lib/Doctrine/Common/Annotations/DocParser.php on line 967

TCMA

The tcmA gene encodes an efflux transporter shown to act on tetracyclines.

References

  • http://www.ncbi.nlm.nih.gov/pmc/articles/PMC206054/

Notice: Trying to access array offset on value of type null in /home/meglabuser/megares.meglab.org/vendor/doctrine/annotations/lib/Doctrine/Common/Annotations/DocParser.php on line 967

Sequences

Download Sequences

>>MEG_6649|Drugs|Tetracenomycin|Tetracenomycin_MFS_efflux_pump|TCMA
atgagcacggaaacgcacgacgagccgtcaggcgtcgcacacacccccgcttccggtctgcgtggacgtccctggccgac
cctgctcgcggtcgcggtcggcgtgatgatggtggctctggacagcaccatcgtcgccatcgccaacccggccatccagc
aggacctccacgcctcgctggccgatgtgcagtggatcaccaacggctacctgctggcgctcgcggtctccctgatcacc
gccggcaaactgggcgacaggttcgggcaccggcagaccttcctggtcggagtggcgggcttcgccgtcacctccgcggc
catcggcctgtccggcagcgtcgcggcgatcgtcgtcttccgcgttctccagggcctgttcggcgctctgatgcagccgt
cggcgctgggcctgctgcgggtcacgttcccgcccggcaagctcaacatggcgatcggcatctggagcggcgtggtcggc
gcctcgaccgcagccggaccgatcatcggcgggctcctggtgcagcacgtcggctgggaggcggtcttcttcatcaatgt
gccggtcggcctcgcggcactcgtcgccggcctcgtcatcctgaccgacgcgcgcgccgaacgcgccccgaagtccttcg
acgtctccggcatcgtgctcctgtccggggccatgttctgcctggtgtggggtctgatcaaggctccggcctggggctgg
ggcgacctgcggacgctgggcttcctggccgccgccgtgctcgccttcgccggattcacactgcgggagagcagggccac
cgagccgctgatgccgctcgccatgttccgttccgtgccgctgtccgcgggcaccgtgctcatggtcctgatggcgttct
cgttcatcggcggactcttcttcgtcaccttctacctgcagaacgtccatggcatgagcccggtcgagagcggtgtgcac
ctgctgccgctcaccggcatgatgatcgtcggcgcccccgtgtccggcatcgtgatcagccggttcggaccaggcgggcc
gctggtggtgggcatgctcctgacggcggcgtccctgtgggggatgtcgacgctggaagcggacagcggtatggggatca
cctcgctctggttcgtgctgctgggtctcggtctcgcgccggtgatggtggggacgacggacgtcatcgtcagcaacgcc
ccggccgaactggccggtgtggccggtggtcttcagcagtccgcgatgcaggtcggcggaagtctcggcaccgccgtact
cggtgtcctcatggcctcccgggtcggcgacgtcttccccgacaagtgggcggaggcgaacctgccgcgggtgggtccgc
gggaggccgcggcgatcgaggacgcggccgaggtgggagccgtcccgccggccggcaccctccccggccggcacgccggg
acgctctccgaggtggtccactcctcgttcatctcggggatggggctggccttcaccgtggccggtgccgtcgcgctcgt
ggccgccgccgtcgccctgttcaccaggaaggccgagcccgacgagagggccccggaggaattcccggtcccggcgtcca
cggcagggcggggctga