MEGAResFrom MEG, the Microbial Ecology Group

Notice: Trying to access array offset on value of type null in /home/meglabuser/megares.meglab.org/vendor/doctrine/annotations/lib/Doctrine/Common/Annotations/DocParser.php on line 967

FOLP

The folP gene encodes the wild-type dihydropteroate synthase. Mutations in this gene can cause reduced preference for the sulfonamide analogue for PABA, leading to resistance.

References

  • http://www.hindawi.com/journals/ijmicro/2013/367021/

Notice: Trying to access array offset on value of type null in /home/meglabuser/megares.meglab.org/vendor/doctrine/annotations/lib/Doctrine/Common/Annotations/DocParser.php on line 967

Other Groups in Sulfonamide-resistant dihydropteroate synthases

Sequences

Download Sequences

>>MEG_2934|Drugs|Sulfonamides|Sulfonamide-resistant_dihydropteroate_synthases|FOLP|RequiresSNPConfirmation
ATGAAAATTGGAAGGTTTGTGATTGAGGGCAATGCGGCTATCATGGGGATTTTAAATGTGACTCCAGATTCTTTTTCAGA
TGGGGGGTCTTACACTACTGTGCAAAAAGCATTAGATCACGTTGAGCAAATGATTGCTGATGGTGCTAAAATCATCGACG
TTGGTGGAGAATCAACACGTCCAGGTTGCCAATTTGTAAGCGCTACCGATGAAATTGACAGGGTGGTTCCTGTGATCAAG
GCCATCAAAGAAAACTATGATATTCTAATCAGCATTGATACCTATAAAACCGAAACAGCTAGAGCAGCTTTAGAGGCGGG
TGCCGATATTCTCAATGATGTTTGGGCAGGTTTGTACGACGGTCAAATGTTTGCCTTAGCAGCCGAGTACGATGCGCCTA
TCATCTTGATGCATAACCAAGACGAAGAAGTTTATCAAGAGGTAACACAAGACGTTTGTGATTTTCTAGGCAATAGAGCA
CAAGCAGCTCTTGATGCTGGCGTGCCAAAAAACAATATTTGGATTGATCCAGGATTTGGATTTGCCAAATCTGTTCAACA
GAATACGGAGTTATTAAAAGGATTGGACCGCGTCTGTCAGTTGGGCTATCCTGTCTTGTTTGGTATTTCGAGAAAGCGTG
TCGTAGATGCCTTGTTAGGCGGCAATACCAAAGCTAAAGAGCGAGACGGAGCGACAGCAGCCTTGTCTGCTTATGCCCTT
GGAAAAGGCTGTCAGATTGTACGCGTACACGATGTCAAGGCTAATCAAGACATTGTGGCTGTGTTGAGCCAGTTGATGTG
A

>>MEG_2935|Drugs|Sulfonamides|Sulfonamide-resistant_dihydropteroate_synthases|FOLP|RequiresSNPConfirmation
GTGAGTTTGGCGCCAGTGCAGGTTATTGGGGTTTTGAACGTCACTGACAATTCGTTCTCAGATGGCGGACGTTACCTTGA
TCCTGACGATGCTGTCCAGCACGGCCTGGCAATGGTCGCGGAAGGCGCGGCGATTGTCGACGTCGGTGGCGAATCGACCC
GGCCCGGTGCCATTAGGACCGATCCTCGAGTTGAACTCTCTCGTATCGTTCCTGTCGTAAAAGAACTTGCAGCACAGGGG
ATTACAGTAAGTATCGATACTACGCGCGCTGATGTTGCACGGGCGGCGCTGCAAAGCGGCGCACGGATCGTCAACGATGT
GTCTGGTGGGCGAGCAGATCCCGCGATGGCTCCTCTGGTGGCTGAAGCCGGTGTTGCGTGGGTGTTGATGCACTGGCGAC
TGATGTCGGCTGAACGGCCGTATGAGGCTCCGAATTACCGCGACGTGGTGGCTGAAGTGCGTGCCGACCTACTGGCTGGT
GTCGATCAGGCTGTGGCCGCAGGTGTTGATCCTGGGAGTCTAGTGATCGATCCCGGGCTTGGATTCGCCAAGACGGGACA
GCACAATTGGGCGCTGCTGAATGCGTTACCGGAGTTGGTGGCTACTGGGGTCCCGATTCTACTTGGCGCCTCGCGTAAAC
GGTTCCTGGGTAGGTTATTAGCTGGGGCTGATGGCGCGGTACGACCGCCGGACGGACGTGAGACGGCGACCGCGGTGATT
TCCGCACTTGCTGCCCTACACGGGGCTTGGGGTGTTCGGGTGCACGATGTGCGTGCCTCGGTCGACGCACTCAAGGTCGT
CGGGGCTTGGCTGCATGCTGGGCCGCAGATTGAAAAGGTTAGATGTGATGGCTGA

>>MEG_2936|Drugs|Sulfonamides|Sulfonamide-resistant_dihydropteroate_synthases|FOLP|RequiresSNPConfirmation
ATGCCGAATTTCGTATGCGGTCGGTTTGAACTCGATCTGACGCAGCCACGCATCATGGCCATCATCAACGTGACCGATGA
TTCATTCTCGGGTGATGGCTTGAGAGGAAATCTGGACGGGGCCTTGAATAAGGCGGAGCGTGCCCTGGCCGAAGGGGCGG
ATATCCTCGATCTCGGCGCGGAGTCCACCCGTCCGGGCAGTGATCCGGTACCCGAGCAGCAGGAGATCGACCGGCTGGTA
CCGCTTATCGAGGCCTTGCAGGGCTGCGGTGTGCCGCTATCGGTGGATACGCTGAAGCCTTCGGTGATGCGCGCCGCGCT
TGCGGCAGGTGCGGACCTGATCAACGACGTCAACGGATTCCGGGCGGAAGGCGCGGTCGAGGCTGTCGCGGCCGGCACAG
CGGGGCTCTGCGTGATGCACATGCAGGGCGAACCGCGGACGATGCAGCAGGCGCCCCAGTACGCCAATGTCGTCGATGAG
GTCGGCGCCTTTCTGGTTCGGCGAACGGAAGTGCTCCTGCGGGCAGGAGTCCGCCGCGAGCGGGTGTTGCTGGATCCCGG
ATTCGGTTTCGGCAAGAGCACCGAGCACAACCTGGCCCTGGTTCGCGGACTCGGGGCGCTGCGTGATCTCGGCTACCCGT
TGTTGGTGGGTTTGTCGCGCAAGAGTCTGTTGGGCGCGATTACCGGCAAGCCGGTGGAGGCGCGTGGTCCGGCCAGTGTG
GCTGCGGCGCTGATGGCGGTTCAGTACGGTGCCGCGATCGTTCGTGTGCACGATGTGGCGCCGACCCGCGATGCACTCGC
GGTGTGGCAAGCAATGTCATAA

>>MEG_2937|Drugs|Sulfonamides|Sulfonamide-resistant_dihydropteroate_synthases|FOLP|RequiresSNPConfirmation
ATGAAATTTTTTAAAATCAATCCAAACACCGATTTTAACTTGCTTTGTTCTCTTATAAACCCTCATAAAATGGGGCAAAA
GATTATGAGTGAGAAAACAAAAACTCATTATATTTTTATCAAAGATATTTCTACTCCTGCAGCAAATATTTTAAAACAAG
ATGCTTTAAGAGTAGGAGCTGAACTTATTACCCATAAAGAAGTAATTACTGCAAAAATCACTCATTCAAATGCGCTTTTA
ATGGCAAGTAAAGAACAAATTCAAAAGCTTATTGCTAAAGAAAAACTTCAAGATTTTGGACTTAAAAATTTGGCTCTTTT
TTTGCAAAAAGATTTTTTAAAACCAAAAAAAGCCGAGCTTATGGCAGTGATTAACGTCAATGAAGACAGTTTTAATGCAA
AAAGTCGTGTGAGTGAAAAAGACTTTGAAAAAAGGCTTAATGATTTTCTTGCTTTAAAGCCTGAGTATATCGATATAGGT
GCAGTAAGTTCAAGACCTGGGAGTGAGTATTGTGGTAAGGAAGAAGAATTTAAAAGACTCAAAAAAATACTTGACTTAAT
TCATGAGAAAAATTATCACGAAAAAGCGATTTTTAGTTTAGATAGTTTTGATGAGTATTGTCTAGAATATGCCTTAAATA
AGGGTTTTAAACTCATTAATGATATTACAAGTTTAAGAAATCTTAATCTAGCTAAACTTGCAAGTAAATATGAGGCAAAA
TATTGCTTAATGCACATGCAAAACAATCCAAATAACATGCAAGATAATCCTTTTTATGAAGATTTACTTGATGAGATGAC
TTTGTTTTTTAAAGAAAAACTTGAACTTTTAGAAAGTTTTGGAGTAAAAGAAAGTATTTTAGATGTAGGTATTGGCTTTG
GAAAGAGTGCGGAGCATAATATGATTTTAATCAAACATTTGGAGCATTTTTTGCAATTTAATAAACCTTTGCTTATAGGT
GCGAGTCGCAAAAGTGTGATTAATGCATATTTTCAAAGCGAGATTAAAGATCGTTTGGCAGGGACTTTGTATTTGCATTT
AAAGGCTTTTGAAAATGGTGCTAGTATTATAAGAGTGCATGATTTATATGAGCACAAACAACTTTTTGCTTTAGTACAGG
CAATGGATAATATAGGAGTTTAG

>>MEG_2938|Drugs|Sulfonamides|Sulfonamide-resistant_dihydropteroate_synthases|FOLP|RequiresSNPConfirmation
ATGCAGTTAATATCTTTACCAAAGCAGATTTTACAGTGTGGACAGCTTCAATTAGATTTATCTCAGCCCCATGTTATGGG
TATCTTAAACGTCACTCCTGATTCTTTCAGTGATGGTGGCAAACATAACCAATTAGACCAAGCGGTTGACCATGCACTTA
GTATGATTGAGCAAGGCGCGACTATTATTGATATTGGGGGGGAGTCTACCCGTCCTGGTGCTTCAGAAGTTGCAGTAGAA
GAAGAAGTGCGTCGTGTGGTACCTGTCGTCGAGGCTTTATCTCACCATAACGTTATTTTGTCGATCGACACGAGTCAGCC
AGAAGTTATTCGCGCAGCAAAAGCAGCAGGGGCACATATCTGGAATGATGTTCGTGCCTTAACAGGTCCCAATGCTTTAA
AAACTGCCGTAGAGTTAGATATACCTGTAGTAATTATGCATATGCGCGGTGAGCCAACGACAATGAATCAGTTGGATCAG
TACACTGATGTAACACTCGATGTGATGCAAGAGCTGCAACAGCGTATTGATGAGGCTTTGGCTGCTGGGGTAAAAAAGCA
CAATATTATTGTTGATCCTGGATTTGGCTTTGCGAAAAATGCTCAGCAAAATTTAAAACTATTAAAAGAATTTTGGAAAC
TTAATGAACTTGGTTATCCAATTTTATCTGGCCTTTCTCGTAAACGTTTCATAGGTGAAGCTTTACAAGGCGCTCCTGCA
GATCAACGTGCTGTGGGAAGTGTAACTGGGCATTTGCTTAGTATTCAGCAGGGAGCATCTATTGTAAGAGCGCATGATGT
AAAGGAAATGCATGAAGCAATTTTAGTTTGGAAAGCGATGCAGCAAGCCTAA

>>MEG_2939|Drugs|Sulfonamides|Sulfonamide-resistant_dihydropteroate_synthases|FOLP|RequiresSNPConfirmation
ATGCCTGCCAAGCTTCGTGCGCGGCGCGAGTTGAACTGTGGCCAGTATGTTCTGCCACTGGGGGAGCGTACGCTAGTCAT
GGGAATTTTGAATGTGACACCTGATTCTTTCTCGGATGGCGGCCGTTATGTCAATGTGGAGGCAGCACTCGCACAAGCGC
GTGCAATGGTTGAGGCTGGAGCTGACCTGATTGATATCGGTGGAGAATCGACACGTCCGGGGTCGGAAGCAGTCGATGAG
GCGACGGAGCTGGACAGAGTGCTGCCAGTCATTCGGATGCTTTCGCAGGAATTGTCTGTTCCGCTGTCCATTGACACGTA
CAAAGCGGCGGTTGCAGAACGGGCTATTCTGGAGGGGGCACATATCATCAATGATGTATGGGGAGCGAAGCGTGACCCGC
GGATGGCAGAGGTAGCTGCTCGTCTCGATGTGCCCATTATCCTGATGCACAACCGCGAAGACACGGACTATCACGACTTT
TTCCCAAACTATATCAAAGACCTGCGTGAGTCCGTACAGATCGCCTTGCAGGCAGGGGTAAAGCAGGAGAGAATCATCCT
CGATCCGGGGATCGGGTTTGTAAGGACTGTCGAGCAAAATCTCGAAACAATGCGCAGGCTGGATGATCTGGTAGGGCTGG
GCTATCCTGTTCTACTTGCTACTTCACGCAAGCGGATGATCGGTCATGTTCTCGACTTGCCTGTAGATGAGCGTGTCGAA
GGTACGGCAGCGACAGTTGCTCTCGGGGCGGCAAAAGGCTGTCATATGGTACGGGTGCATGATGTCAAAGAAATGAAGCG
CGTTACGAAGATGATGGACGCGATGCTAAAAGGGGGCATTTAA

>>MEG_2940|Drugs|Sulfonamides|Sulfonamide-resistant_dihydropteroate_synthases|FOLP|RequiresSNPConfirmation
ATGATTATAGAATTAAATAAAAATAGTTTCCCAGAAGAGTTCAATAAGATAGAAGTACATGAGGGTAGTGTGAATATATT
TATGAATAAAAATAGTATTACCCCTTTAAAAATTTTTAATGTGCTAGCTCCTGCGGCCAATATAATAAAGCAAGAAATAC
TGGCTTTAGGTGGAGATTGTGCTGTAAATAAATATTGTATAAATTGCAAAGTGGAAACTTCAGATATAATTTTATTAGGA
ACCAAAAGACAGTACAAAAAATTATTGCAAAAGCTTAAATGCATGACTTTTTTTAGAATAGAAGAAATAGTAGGGGAATT
AGAAAATTATATTAACAATCATAAAAAAATTAAAACGGTTTTAAGAGATGGAAGAGAAATAAACTATGAGAATTTAAAGG
TTATGGGAATTATAAATTGTACTCCAGATTCTTTTTATGAGGGCTCTAGAAAAAATTCTATAGAAGAAGCTTTAAAAACT
GCAGAAAAGATGTTAAAAGAAGGGGCAGAAATTTTAGATATAGGTGGAGAATCCACAAGACCAGGTTCTGACCCAGTAGA
TGAAGAGGAAGAAATAAAAAGAGTAGTTCCTGTTATAAGAGAGATAAAGAATAAATTTAAGGATGTCATAATTTCCATAG
ATACTTATAGAGCAAATACGGCAAAGGCTGCCATAGAGGCAGGTGCAGACATAGTAAATGATATAAGTGCTATGAAGTAT
GATGAAAATATGGTGAAAGTAGTTAAAGAATACAATATACCTGTAATACTTATGCATGTAAAAGGAAAACCAAAGGATAT
GCAAATAGATCCAGTTTATGAGAATTTAATGAAAGAAATTCATCTTTATTTTAATGAGAGAATAGAGTACTGCAAATCTC
ATGGCATAACAGAGGATAAAATAATATTAGATCCAGGCATAGGTTTTGGAAAAACTGTAGAGCATAATCTAAAAATAATG
AACAGATTAGAAGAATTGAAAAGCTTTAATCTTCCAGTACTTTTAGCAGCCTCAAGAAAAGCCACAATAGGAAAAGTTTT
AGGAAACTTATCTACAGAAGAAAGATTAGAAGGAACTATAGCTTTATCCTGTTTAGCTGTAAATTCAGGACTTCAAATGG
TGAGAGTACACGATGTTAAAGAAAATGTAAGAGCCATAAGAATGTTAGAGGCAGTAAGAAAAATATAA

>>MEG_2941|Drugs|Sulfonamides|Sulfonamide-resistant_dihydropteroate_synthases|FOLP|RequiresSNPConfirmation
ATGCGGCCCACCATGCGACAGATACGTTCCACTGCGCCCATAAGCGGCCCTGGCGACTCCATGGAGCAGGACATGGCCTC
GATCTGGCGGTTGGGCGGCGGGCGGACCCTGGACTGCTCCGGGGACCGCGTCATTGGCATCGTCAACGCCACGCCCGACT
CCTTCTACGACGGCGGCCGCCACGGCGACGTGGCGGCCGCCGTATCCCATGGCCTGCGTCTGGCCGGGGAAGGGGCCGAC
ATGCTCGACATCGGCGGCGAGTCCACCCGCCCCGGGGCCGCGCCTGTCACCGACGCCGAAGAAATCGACCGGGTCGTGCC
GGTCATCGCCGAGCTTGCCCGCCGACTGCCGGACATGCCCATTGCCGTGGACACCTACCGGGCCGGCTGCGCCACCGCCG
CCCTGGCCGCCGGAGCCTGCGCGGTCAACGACGTGTCGGGGCTGGCTTTCGATCCGGCGCTGCTTGAGGTCGTTGCGCAG
CGCCAGCCCGGCTACGTGCTCATGCATACCAAAGGCCGGCCTGACGTCATGCAGCGCGACCCCCGTTACGACGATGTAAT
CGGCGAAATCCTGGCCTATTTCGAACAGGGGCTCACGCGCCTGACTCGGGCCGGGCTGCCTGAGGACCATGTGGTCCTTG
ATCCCGGCATCGGTTTCGGCAAGCTCTCGGAGCACAATCTGGAAATTTTGCGCAATCTTGAACGGTTTACGGTCTTTGGC
CGGCCGGTCTATCTCGGGCTGTCCAACAAGTCGTTTTTCGGCGCGCTCCTTGGGCTGCCCGTGGGCGAGCGCACCGTGGC
CACGGCCGTGGCCTCGGCCCTGTGCGCCGGGCGCGGGGCGCGCCTGCACCGCGTCCACGACGTCGCCGCCGTCAAACAAG
CCCTGGGCCTGGCCGCCGCCCTGGCCGGCTGA

>>MEG_2942|Drugs|Sulfonamides|Sulfonamide-resistant_dihydropteroate_synthases|FOLP|RequiresSNPConfirmation
ATGATTGATTTAAAAAAGAATTACCAAATTATGGGGATTGTCAACACGACCCCCGACTCTTTTTCTGATGGCGGTAGCTA
CACAACGGTCGACGTGGCCTATCAACATGCGCTTCATCTACTAGAAGCGGGGGCCGATATTTTAGACATTGGCGGCCAAT
CCACACGTCCTGGCTACGAAGAAGTTTCTCCACAAGTTGAGGCAGACCGAGTATTACCATTAATAAAAAAAATACGTGAG
ACTTCTCTAGCGCCGATTTCTGTGGACACCTACTATCCCGAAGTAGCGGAAGCCGCGATCCAAGCTGGCGCCACAATGAT
TAATGACATCAAAGGATTAGACACTCCGGGGATGGCAGAAGTCCTCGCACAATATCCTGAAGTCCAAGTTGTGATTATGC
ATTCTAGAAAACGCCAATCGCTTTCTTTAAAAGAAGAGTTGCACCAATTTTATACAGAAAAAATTGAACAATGCCAAAAA
TATGGGCTTTCCTTAGAAAAAATTTGTTTCGATCCAGGGATTGGCTTTCATAAAACTGTCGCAGAAAACCTTCAACTGTT
AAAAGATCCTAACGCCTTTCGCTACCAAGATTATCCGTTACTATACGGCGTTTCTCGCAAACGAACCATTGGCGCTTTAA
CGAACGAACCAGAACCAGCCAACCGTGATTTTGGCTCAGCCGCTGCTTCCTTGTATGCAGCACAACAAGGCGTAGAAATT
TTACGTGTTCATAATGTCCAAGGCTTAAAACAAACATTTGATGTCTGGCGAGCATTGTCGGAGAAGGAGTAA

>>MEG_2943|Drugs|Sulfonamides|Sulfonamide-resistant_dihydropteroate_synthases|FOLP|RequiresSNPConfirmation
GTGAATTCTGAACAGTTCCTCGGTTGGCTTGAGCGAAAGAGCCAACCTGCTTCTTCCTTGGTTTTTGAAAAGCCGTTAAT
TATGGGTGTGCTAAATGTTACCTCTGATTCATTTTATGATGGTGGCAAGTATCTGTCTGTGGATAGAGCTTATGAGCAAG
CCATACAATTAATTGCATGTGGAGCTGATCTCATTGATATTGGTGGGGAATCAACCAAACCCGGTGCTCCGCCAGTCCCT
TTAGATGTTGAACTATCAAGAGTTCTTCCCATAATCAAACAACTTCGTGCGTTCACAGATGTGTGTATTTCTATTGATAC
AAATAAGCCAGAAGTGATGGAAGCGGCAATTAATGCTGGTGCGCATGTTATAAATGATGTTTATGCTTTAAGAAGGGATG
GTGCTCTGAATGTTGCTGCACAATTAGATGTTCCTGTCTGTTTAATGCACATGAAAGGAGAGCCGCGAACCATGCAAGAA
AATCCTTCTTACCCAGAAGGGATAATGAAGGAATTACAGCATTTTTTTGAAGAACGCATCGATAAATGCCAGAAAGCCGG
GCTGAATAGGAATAAATTAATTCTTGACCCTGGCTTTGGTTTTGGAAAGCGCGTTCAAGATAACCTACAATTAATTTATC
ATCTGAACGAATTGCATTCTTTTGGATTGCCAATTCTTTTGGGCGTTTCACGCAAAAGCACAATTGGTGCCGTGTTGAAT
ACTGAGGTTGAACAACGTTTGATTGGAAGTATTACGCTAGGGATATATGCGGCTCTTAAAGGCACTGCAATTATCAGGAC
ACATGATGTAGATGAAACGAATCAAGCATTAACTATGATTAATGCAATTTATCAAGCTGCTAAAGAAATCAGTTAA

>>MEG_2944|Drugs|Sulfonamides|Sulfonamide-resistant_dihydropteroate_synthases|FOLP|RequiresSNPConfirmation
CTGTTTTCGTTCATTCAAGTTCATAAGGGAATGGCAATGAAACTCTTCGCTCAGGGCTCAACGCTCGAACTTTCTCATCC
GCATGTCATGGGGATCCTGAATGTCACGCCGGATTCTTTTTCCGATGGTGGCCAGCACAACACGCTGACAGAGGCGGTAA
AACACGCCAATGCGATGATTAACGCTGGTGCGACCATCATTGACGTAGGCGGAGAATCGACGCGCCCTGGCGCGGCGGAA
GTGAGTGTGGAAGAAGAGCTTTCCCGCGTGGTGCCGGTGGTGGAAGCGCTGGCGCAGCGTTTTGAGGTCTGGGTGTCGGT
CGATACGTCTAAACCAGAAGTGATCCGCGAGTCGGCGCGGGTCGGCGCGCATATCATCAACGATATTCGCTCGCTGACGG
AGCCTGGTGCGCTTGAGGCGGCGGCAGAGACCGGTTTGCCGGTGTGTCTGATGCATATGCAGGGCCAGCCGAAAACGATG
CAGCAGGCGCCGCACTATGAAGATGTTTTTGCCGACGTCACGCGTTTTTTTGAGCAACAGATCGCCCGCTGCGAAGCGGC
AGGCATTACAAAAGAAAAAATCATACTCGACCCGGGATTCGGTTTCGGTAAAAATCTGACCCACAATTACCAGCTTCTCG
CCCGGCTTTCAGAATTCCAGCGTTTCGAAATGCCTTTGCTGGTGGGAATGTCGCGTAAGTCGATGATTGGACAACTACTT
AATGTCGGGCCCGATCAGCGTCTGCCCGGAAGCCTTGCCTGCGCGGTGATGGCGGCCATGCAGGGGGCGCAGATTATTCG
GGTTCATGACGTCAAAGAAACCGTCGAAGCGATGCGCGTGGTGGAAGCAACTCTTTCAGCGAAGGATAAAAAATGTTATG
AGTAA

>>MEG_2945|Drugs|Sulfonamides|Sulfonamide-resistant_dihydropteroate_synthases|FOLP|RequiresSNPConfirmation
ATGACTAAAACAAAAATTATGGGCATATTAAACGTCACACCTGATTCATTCTCAGATGGTGGAAAATTTAATAATGTTGA
ATCAGCTATAAATAGAGTGAAAGCCATGATAGATGAAGGTGCTGACATTATAGATGTTGGAGGTGTTTCAACGAGACCAG
GTCATGAAATGGTTTCATTAGAAGAAGAGATGAACAGAGTATTACCTGTTGTTGAAGCTATTGTCGGTTTTGATGTAAAA
ATTTCAGTCGATACATTTCGAAGTGAGGTTGCTGAAGCATGTTTAAAATTAGGCGTTGATATGATTAATGATCAATGGGC
GGGTCTGTATGATCATCGTATGTTCCAAATTGTAGCTAAATATGACGCGGAAATTATTTTAATGCATAATGGAAATGGTA
ATCGTGATGAACCGGTTGTCGAAGAAATGTTAACATCTTTGTTAGCACAAGCACATCAAGCTAAAATAGCTGGTATACCT
TCAAATAAAATTTGGCTAGATCCAGGTATAGGTTTCGCTAAAACTAGAAATGAAGAAGCCGAAGTTATGGCAAGACTGGA
TGAACTTGTTGCAACAGAATATCCAGTTTTATTAGCGACAAGCCGGAAACGTTTCACTAAAGAGATGATGGGTTATGATA
CAACACCGGTTGAAAGAGATGAAGTAACTGCAGCTACGACTGCATATGGTATTATGAAAGGCGTTAGAGCAGTACGCGTT
CATAATGTCGAGTTGAATGCTAAATTAGCTAAAGGTATAGATTTTTTAAAGGAGAATGAAAATGCAAGACACAATCTTTC
TTAA

>>MEG_2946|Drugs|Sulfonamides|Sulfonamide-resistant_dihydropteroate_synthases|FOLP|RequiresSNPConfirmation
ATGAAATTAATTGCCAGAGGAAGAGAGCTTAATTTATCTTCACCCCAAGTGATGGGCATTTTAAATGTGACGCCAGATTC
ATTTTCTGATGGCGGAACGCATAACTCTCTTAATGATGCTATTAACCACGCCGCTAAACTTATTGCTGAAGGGGCTTCTA
TCATCGATATCGGTGGTGAATCAACAAGGCCGGGTGCCAGTGATGTTTCTGTCGATGAAGAATTACATCGTGTTATTCCT
GTGGTCGAAGCTATCCAGCAACGTTTTGATGTGTGGATTTCTGTTGATACATCCAAAGCACAAGTGATCACGGAGTCCGC
TCAAGCTGGTGCCTCTATTATCAATGATATACGTTCACTTACCGAACCTGGAGCACTGCAGGCGGCTGCAAAAACGGGGT
TACCTGTTTGTATTATGCATATGCAAGGTTTACCTAAAACAATGCAACATTCGCCGCAGTATAAGAATGTGATGATAGAA
GTTGATGCTTTTCTAGCAGAGAATATTCAACGTTGTATTGATGCTGGCATCGAGAAAAATCAAATTATTCTTGATCCAGG
CTTCGGCTTTGGTAAAAATTTAGCGCATAATTATCAATTATTAGCACATCTAAGTGATTTTCATCACTTTGGTTTACCGA
TACTCGCCGGAATGTCACGTAAATCAATGGTAGGACAGTTACTCAATGTTCCGCCACAAGAGCGTGTTGCTGGTAGTGTT
GCTTGCGCAGTTATTGCTGCAATGCAAGGGGCACAAATTATTCGTGTACACGATGTTAAAGAGACTGTAGATGCGATGAA
AGTCGTGCAGGCGACTCTTTCTGCAAAGGAAAATAATGAATGA

>>MEG_2947|Drugs|Sulfonamides|Sulfonamide-resistant_dihydropteroate_synthases|FOLP|RequiresSNPConfirmation
ATGGGTGTCTTAAATGTTACCTCGGACTCATTTTATGATGGTGGCAAGTATCTGTCTGTTGATAGAGCCTGTGATCAGGC
TTTAAAATTAATTGCATGTGGAGCTGATCTCATTGATATAGGTGGGGAATCAACCAAACCTGGTGCGCCGCCAGTCCCTT
TAGATGTTGAACTATCAAGAGTTCTTCCCGTAATCAAACAACTTCGTGCCCTCGCAGATGTGTGTATTTCTATTGATACT
AATAAGCCTGAAGTGATGGAAGCGGCAATCGATGCTGGTGCGAATGTTATAAATGATGTTTATGCTTTAAGAAGGGATGG
TGCTTTGAATGTTGCTGCGCAGTTAGATGTTCCTGTTTGTTTAATGCACATGAAAGGAGAGCCTCGAACTATGCAAGAAA
ATCCTTCTTACCCAGAAGGAATAATGAAGGAATTACAGCATTTTTTTGAAGAGCGCATCGATAAATGCCAGAAAGCCGGG
CTGAATAAGAATAAATTAATTCTTGACCCTGGCTTTGGTTTTGGAAAGCGCATTAAAGATAACCTAAAATTAATTTATCA
TCTGAACGAATTGCGTTCTTTTGGATTGCCAATTCTTTTGGGCGTTTCACGCAAAAGCACAATTGGTGCTGTATTGAATA
ATGAAGTTGAGCAACGTTTGATTGGAAGTATTACGCTAGGAATATATGCTGCTCTTAAAGGCACTGCAATTATCAGGACA
CATGATGTGGATGAAACGAATCAAGCATTAACTATGATTAATGCAATTTATCAAGCTGCTAAAGAAATCAGTTAA

>>MEG_2948|Drugs|Sulfonamides|Sulfonamide-resistant_dihydropteroate_synthases|FOLP|RequiresSNPConfirmation
ATGAAACTCTTCGCTCAGGGCGCCACGCTCGATCTCACTCATCCGCATGTTATGGGGATCCTGAACGTAACGCCGGATTC
GTTCTCCGACGGCGGCGCGCATAACACGCTGATTGAGGCGGTGAAACATGCGAATTTAATGGTGAATGCCGGGGCGACAA
TTATTGATGTGGGGGGGGAATCAACGCGACCAGGCGCGGCGGAAGTGAGCGTGGAAGAAGAGCTGGATCGCGTTATTCCG
GTACTGGAAGCAATCGCGCAACGTTTTGAAGTGTGGATTTCTGTGGATACCTCTAAACCCGAGGTGATCCGTGAAGCGGC
AAGGGCGGGCGCGCATATTATCAATGATGTCCGTTCGCTCTCCGAGCCCGGCGCGTTGGAAGCGGCAGCGGAAACCGGCT
TGCCGGTCAGTCTTATGCACATGCAGGGCAACCCCAAAACCATGCAGGAGGCGCCGAAATATGACGATGTCTTTGCCGAG
GTGAATCGCTACTTTATTGAGCAAATAGCACGTTGTGAGAAGGCCGGCATCGCAAAAGAGAAATTGTTGCTCGACCCCGG
ATTCGGTTTCGGTAAAAATCTCTCTCACAATTATACCTTACTGGCGCGACTGGGTGAGTTTCATCATTTTAACCTGCCGC
TGCTGGTGGGCATGTCACGTAAAACGATGGTTGGTCAGTTACTTAACGTGGGACCATCAGACCGTCTGAACGGCAGCCTT
GCGTGCGCGGTAATTGCCGCGATGCAGGGCGCGCAGATCATTCGCGTCCATGACGTCAAAGAAACCGTAGAGGCGATGCG
GGTGGTGGAAGCCACTCTGTCTGCAAAGGGAAACAAACGCTATGAGTAA

>>MEG_2949|Drugs|Sulfonamides|Sulfonamide-resistant_dihydropteroate_synthases|FOLP|RequiresSNPConfirmation
ATGACTAAAACAAAAATTATGGGCATATTAAACGTCACACCTGATTCATTCTCAGATGGTGGAAAATTTAATAATGTTGA
ATCAGCTATAAATAGAGTGAAAGCCATGATAGATGAAGGTGCTGACATTATAGATGTTGGAGGTGTTTCAATGAGACCCG
GTCATGAAATGGTTTCATTAGAAGAAGAGATGAACAGAGTATTACCTGTTGTTGAAGCTATTGTCGGTTTTGATGTAAAA
ATTTCAGTCGATACATTTCGAAGTGAGGTTGCTGAAGCATGTTTAAAATTAGGCGTTGATATGATTAATGATCAATGGGC
GGGTCTGTATGATCATCGTATGTTCCAAATTGTAGCTAAATATGACGCGGAAATTATTTTAATGCATAATGGAAATGGTA
ATCGTGATGAACCGGTTGTCGAAGAAATGTTAACATCTTTGTTAGCACAAGCACATCAAGCTAAAATAGCTGGTATACCT
TCAAATAAAATTTGGCTAGATCCAGGTATAGGTTTCGCTAAAACTAGAAATGAAGAAGCCGAAGTTATGGCAAGACTGGA
TGAACTTGTTGCAACAGAATATCCAGTTTTATTAGCGACAAGCCGGAAACGTTTCACTAAAAAGATGATGGGTTATGATA
CAACACCGGTTGAAAGAGATGAAGTAACTGCAGCTACGACTGCATATGGTATTATGAAAGGCGTTAGAGCAGTACGCGTT
CATAATGTCGAGTTGAATGCTAAATTAGCTAAAGGTATAGATTTTTTAAAGGAGAATGAAAATGCAAGACACAATCTTTC
TTAA

>>MEG_2950|Drugs|Sulfonamides|Sulfonamide-resistant_dihydropteroate_synthases|FOLP|RequiresSNPConfirmation
ATGACTAAAACAAAAATTATGGGCATATTAAACGTCACACCTGATTCATTATCAGATGGTGGAAAATTTAATAATGTTGA
ATCAGCTATAAATAGAGTGAAAGCCATGATAGATGAAGGTGCTGACATTATAGATGTTGGAGGTGTTTCAACGAGACCCG
GTCATGAAATGGTTTCATTAGAAGAAGAGATGAACAGAGTATTACCTGTTGTTGAAGCTATTGTCGGTTTTGATGTAAAA
ATTTCAGTCGATACATTTCGAAGTGAGGTTGCTGAAGCATGTTTAAAATTAGGCGTTGATATGATTAATGATCAATGGGC
GGGTCTGTATGATCATCGTATGTTCCAAATTGTAGCTAAATATGACGCGGAAATTATTTTAATGCATAATGGAAATGGTA
ATCGTGATGAACCGGTTGTCGAAGAAATGTTAACATCTTTGTTAGCACAAGCACATCAAGCTAAAATAGCTGGTATACCT
TCAAATAAAATTTGGCTAGATCCAGGTATAGGTTTCGCTAAAACTAGAAATGAAGAAGCCGAAGTTATGGCAAGACTGGA
TGAACTTGTTGCAACAGAATATCCAGTTTTATTAGCGACAAGCCGGAAACGTTTCACTAAAAAGATGATGGGTTATGATA
CAACACCGGTTGAAAGAGATGAAGTAACTGCAGCTACGACTGCATATGGTATTATGAAAGGCGTTAGAGCAGTACGCGTT
CATAATGTCGAGTTGAATGCTAAATTAGCTAAAGGTATAGATTTTTTAAAGGAGAATGAAAATGCAAGACACAATCTTTC
TTAA

>>MEG_2951|Drugs|Sulfonamides|Sulfonamide-resistant_dihydropteroate_synthases|FOLP|RequiresSNPConfirmation
ATGACTAAAACAAAAATTATGGGCATATTAAACGTCACACCTGATTCATTCTCAGATGGTGGAAAATTTAATAATGTTGA
ATCAGCAGTAACTAGAGTGAAAGCGATGATGGATGAAGGTGCTGACATTATAGATGTTGGAGGTGTTTCAACGAGACCCG
GCCATGAAATGATTACTGTGGAAGAAGAGTTGAATAGAGTATTACCAGTTGTTGAAGCGATTGTCGGTTTTGATGTAAAA
ATTTCGGTTGATACTTTTCGTAGTGAAGTTGCTGAAGCTTGTTTAAAGCTAGGTGTTGATATTATTAATGATCAATGGGC
AGGCCTTTATGATCATCGCATGTTTCAAGTTGTAGCCAAATACGATGCGGAAATTGTTTTAATGCATAATGGCAATGGTA
ATCGTGATGAACCGGTTGTCGAAGAAATGTTAACATCTTTGTTAGCACAAGCACATCAAGCTAAAATAGCTGGTATACCT
TCAAATAAAATTTGGCTAGATCCAGGTATAGGTTTCGCTAAAACTAGAAATGAAGAAGCCGAAGTTATGGCAAGACTGGA
TGAACTTGTTGCAACAGAATATCCAGTTTTATTAGCGACAAGCCGGAAACGTTTCACTAAAGAGATGATGGGTTATGATA
CAACACCGGTTGAAAGAGATGAAGTAACTGCAGCTACGACTGCATATGGTATTATGAAAGGCGTTAGAGCAGTACGCGTT
CATAATGTCGAGTTGAATGCTAAATTAGCTAAAGGTATAGATTTTTTAAAGGAGAATGAAAATGCAAGACACAATTTTTC
TTAA

>>MEG_2952|Drugs|Sulfonamides|Sulfonamide-resistant_dihydropteroate_synthases|FOLP|RequiresSNPConfirmation
ATGAAACTTGTAGCCCAGGGCTCAACCCTCGATCTCTCTCACCCCCACGTGATGGGTATTCTAAATGTGACGCCTGACTC
CTTCTCCGATGGCGGCGCCCATAATTCGCTGATTGAGGCGGTGAAGCATGCCAATCTGATGATCAACGCCGGCGCGACCA
TCATTGATATCGGCGGTGAATCGACGCGGCCAGGGGCGGCTGAGGTTAGTGTGGAAGAGGAGCTTGCGCGGGTGATACCG
GTGGTTGAAGCCATTGCCCAGCGCTTTGAGGTATGGATCTCAGTGGATACCTCCAAGGCGGAGGTTATTCGCCAATCGGC
CAGGGCCGGGGCGCATATCATCAACGATATTCGTTCGCTGACCGAGCCCGGCGCGCTGCAGGCCGCCGCGGAAACCGGAC
TGCCAGTGTGTCTGATGCATATGCAGGGACAACCAAAAACCATGCAGGAGGCGCCGAAGTATGAGGACGTCTTCGCCGAT
GTTGAGCGTTTTTTTAATGAGCACATTGTGCGCTGCGAACAGGCAGGGATCGCAAAAGAAAAATTGCTGCTCGACCCGGG
ATTCGGTTTCGGTAAAAATCTCTCCCACAATTACCAACTGTTGGCCAGGCTTGGGGAGTTTCATCACTTTGGTCTGCCGC
TGCTGGTCGGTATGTCACGTAAGTCGATGGTAGGTCAGTTGCTGAACGTCGGGCCGTCGGAGCGGCTGAACGGCAGCCTG
GCGTGTGCCGTCATTGCAGCAATGCAGGGCGCGCAGATTATCCGCGTCCATGATGTCAAAGAAACGGTAGAAGCGCTGCG
CGTGGTGGAAGCCACCCTCGCCGCTAAGGGAAAAAAACGTTATGAGTAA

>>MEG_2953|Drugs|Sulfonamides|Sulfonamide-resistant_dihydropteroate_synthases|FOLP|RequiresSNPConfirmation
ATGGCACGACACGTTTGGCAGGCAGGACGGTTTGAAATCGGTTTGGACAAACCGAAAATCATGGGCATCGTGAATCTCAC
ACCCGATTCTTTTTCCGACGGCGGCGTGTATTCGCAAAACGCCCAAACAGCCTTGGCACATGCCGAACAGCTTCTAAAAG
AAGGCGCAGACATTCTCGACATCGGCGGCGAATCGACGCGGTCGGGTGCGGATTATGTTTCGCCTGAAGAAGAATGGGCG
CGGGTTGAGCCTGTTTTGGCGGAAGTGGCGGGGTGGGGCGTTCCCATCAGTTTGGACACGCGCCGCACGGTGATTATGGA
AAAAGCGTTGGCACTCGGCGGCATCGATATTATTAATGATGTGGCGGCGTTGAATGACGAGGGCGCGGTCGAATTGCTGG
CGCGTCAGGCGGACACGGGCATTTGCCTGATGCACATGCAGGGTTTGCCCAAAACCATGCAGATTAATCCGAAATATCAA
GATGTTGTCGGTGAAGTAGCGCGGTATTTGAAAGCGCGCTCAGCGGAATGTATCGCGGCAGGCATCGCACCGCAACGCAT
CATACTCGACCCCGGCTTCGGCTCCGGCTTCGGCAAACCCTTGCAACACAATATCGCGCTGATGCGGCATTTGCCCGAAT
TGATGGCGGAAACAGGTTTTCCGCTGCTCATCGGCGTATCGCGCAAAAGCACGATAGGCGAGCTGACCGGCGAGGCAAAT
GCGGCGGAACGCGTACACGGCAGCGTGGCGGCAGCGTTGGCTTCCGTAGCGCGCGGCGCGCAAATCGTGCGGGTGCATGA
TGTGAAGGCGACAGCGGATGCGTTGAAGGTGTGGGAAGCGTTGGGCATCAATCTGTAA

>>MEG_2954|Drugs|Sulfonamides|Sulfonamide-resistant_dihydropteroate_synthases|FOLP|RequiresSNPConfirmation
ATGGTGACGGTGTTCGGCATTCTGAATCTCACCGAGGACTCCTTCTTCGATGAGAGCCGGCGGCTAGACCCCGCCGGCGC
TGTCACCGCGGCGATCGAAATGCTGCGAGTCGGATCAGACGTCGTGGATGTCGGACCGGCCGCCAGCCATCCGGACGCGA
GGCCTGTATCGCCGGCCGATGAGATCAGACGTATTGCGCCGCTCTTAGACGCCCTGTCCGATCAGATGCACCGTGTTTCA
ATCGACAGCTTCCAACCGGAAACCCAGCGCTATGCGCTCAAGCGCGGCGTGGGCTACCTGAACGATATCCAAGGATTTCC
TGACCCTGCGCTCTATCCCGATATTGCTGAGGCGGACTGCAGGCTGGTGGTTATGCACTCAGCGCAGCGGGATGGCATCG
CCACCCGCACCGGTCACCTTCGACCCGAAGACGCGCTCGACGAGATTGTGCGGTTCTTCGAGGCGCGGGTTTCCGCCTTG
CGACGGAGCGGGGTCGCTGCCGACCGGCTCATCCTCGATCCGGGGATGGGATTTTTCTTGAGCCCCGCACCGGAAACATC
GCCGCCCGTGCTGTCGAACCTTCAAAAGCTGAAGTCGGCGTTGGGGCTTCCGCTATTGGTCTCGGTGTCGCGGAAATCCT
TCTTGGGCGCCACCGTTGGCCTTCCTGTAAAGGATCTGGGTCCAGCGAGCCTTGCGGCGGAACTTCACGCGATCGGCAAT
GGCGCTGACTACGTCCGCACCCACGCGCCTGGAGATCTGCGAAGCGCAATCACCTTCTCGGAAACCCTCGCGAAATTTCG
CAGTCGCGACGCCAGAGACCGAGGGTTAGATCATGCCTAG

>>MEG_2955|Drugs|Sulfonamides|Sulfonamide-resistant_dihydropteroate_synthases|FOLP|RequiresSNPConfirmation
GTGCTCCGGGGTTTTTTCTTATCAATTCATACCAGGGATAACATCATGAAACTCTTTGCCCAGGGTACTTCACTGGACCT
TAGCCATCCTCACGTAATGGGGATCCTCAACGTCACGCCTGATTCCTTTTCGGATGGTGGCACGCATAACTCGCTGATAG
ATGCGGTGAAACATGCGAATCTGATGATCAACGCTGGCGCGACGATCATTGACGTTGGTGGCGAGTCCACGCGGCCAGGG
GCGGCGGAAGTTAGCGTTGAAGAAGAGTTGCAACGTGTTATTCCTGTGGTTGAGGCAATTGCTCAACGCTTCGAAGTCTG
GATCTCGGTCGATACATCCAAACCAGAAGTCATCCGTGAGTCAGCGAAAGTTGGCGCTCACATTATTAACGATATCCGCT
CCCTTTCCGAACCTGGCGCTCTGGAGGCGGCTGCAGAAACCGGTTTACCGGTTTGTCTGATGCATATGCAGGGAAATCCA
AAAACCATGCAGGAAGCCCCGAAGTATGACGATGTCTTTGCAGAAGTGAATCGCTACTTTATTGAGCAAATAGCACGTTG
CGAGCAGGCGGGTATCGCAAAAGAGAAATTGTTGCTCGACCCCGGATTCGGTTTCGGTAAAAATCTCTCCCATAACTATT
CATTACTGGCGCGCCTGGCTGAATTTCACCATTTCAACTTGCCGCTGTTGGTGGGTATGTCACGAAAATCGATGATTGGA
CAGCTGCTGAACGTGGGGCCGTCCGAGCGTTTGAGCGGTAGTCTGGCCTGTGCGGTCATTGCCGCAATGCAAGGCGCGCA
CATCATTGGTGTTCATGACGTCAAAGAAACCGTAGAAGCGATGCGGGTGGTGGAAGCCACTCTGTCTGCAAAGGAAAACA
AACGCTATGAGTAA

>>MEG_2956|Drugs|Sulfonamides|Sulfonamide-resistant_dihydropteroate_synthases|FOLP|RequiresSNPConfirmation
ATGACTAAAACAAAAATTATGGGCATATTAAACGTCACACCTGATTCATTCTCAGATGGTGGAAAATTTAATAATGTTGA
ATCAGCAGTAACTAGAGTGAAAGCGATGATGGATGAAGGTGCTGACATTATAGATGTTGGAGGTGTTTCAACGAGACCCG
GCCATGAAATGATTTCATTAGAAGAAGAGCTGAACAGAGTATTACCTGTTGTTGAAGCTATTGTCGGTTTTGATGTGAAA
ATTTCGGTTGATACTTTTCGAAGTGAGGTTGCTGAAGCATGTTTAAAATTAGGCGTTGATATTATTAATGATCAATGGGC
AGGCCTTTATGATCATCGCATGTTTCAAGTTGTAGCCAAATACGATTCGGAAATTGTTTTAATGCATAATGGCAATGGTA
ATCGTGATGAACCGGTTGTCGAAGAAATGTTAACATCTTTGTTAGCACAAGCACATCAAGCTAAAATAGCTGGTATACCT
TCAAATAAAATCTGGCTAGATCCAGGTATAGGTTTCGCTAAAACTAGAAATGAAGAAGCTGAAGTTATGGCAAGACTGGA
TGAACTTGTTGCAACAGAATATCCAGTTTTATTAGCGACAAGCCGGAAACGTTTCACTAAAGAGATGATGGGTTATGATA
CAACACCGGTTGAAAGAGATGAAGTAACTGCAGCTACGACTGCATATGGTATTATGAAAGGCGTTAGAGCAGTACGCGTT
CATAATGTCGAGTTGAATGCTAAATTAGCTAAAGGTATAGATTTTTTAAAGGAGAATGAAAATGCAAGACACAATCTTTC
TTAA

>>MEG_2957|Drugs|Sulfonamides|Sulfonamide-resistant_dihydropteroate_synthases|FOLP|RequiresSNPConfirmation
ATGGTGAAAAGCCTTGAGGGAGTGACCGATATGTTAAGTAAAGCCAATCGTGCAAAGACAGCTATTTGCGGAATTATCAA
TGTAACCCCAGACTCCTTTTCGGACGGTGGTCAATTTTTTGCTCTTGAGCAGGCACTCCAGCAGGCTCGTAAATTGATAG
CAGAAGGGGCTAGCATGCTAGATATCGGTGGAGAATCAACTCGGCCGGGAAGTAGCTATTATGTTGAGATAGAAGAGGAG
ATCCAGCGTGTTGTTCCAGTGATTAAAGCGATTCGCAAGGAAAGTGATGTCCTCATTTCTATTGATACTTGGAAAAGTCA
GGTTGCAGAGGCTGCTTTGGCTGCTGGTGCCAATCTAGTCAATGATATCACTGGTCTCATGGGTGATGAAAAAATGGCCC
ATGTGATAGCTAAAGATGGAGCGAAAGTGGTCATTATGTTTAATCCTGTTATGGCTCGACCTCAGCATCCTAGCTCGCTC
ATATTCCCTCATTTTGGATTTAATCAAGCTTTTACAGAGGAAGAGTTAGCTGACTTTGAAACATTGCCAATCGAAGAGTT
GATGGAGACTTTCTTTGAAAGAGCACTAGCGAGAGCAAATCAAGCTGGAATTGCACAAGAAAATATCCTGTTGGATCCAG
GAATCGGCTTTGGGCTGACTAAGAAAGAAAATTTGCTTCTTTTACGAGACCTGGATAAACTACATCAGAAGGGCTATCCA
ATCTTTCTTGGAGTGTCGCGCAAGAGGTTTGTCATCAATATCCTTGAAGAAAATGGTTTTGAAGTCAATCCTGAGACAGA
ACTTGGTTTCCACAATCGGGACACAGCTTCGGCTCATGTAACCAGTATCGCTGCGAGACAGGGTGTGGAAGTGGTGCGCG
TGCATGACGTAGCTAGTCACAGGATGGCAGTTGAAATTGCCTCCGCCATTCGTCTGGCTGATGAAGCGGAAAATCTAGAT
TTAAAACAATATAAATAA

>>MEG_2958|Drugs|Sulfonamides|Sulfonamide-resistant_dihydropteroate_synthases|FOLP|RequiresSNPConfirmation
ATGAGCAATCCGCAATACCCGACCCGACTGCCTTGCGGCAGTCGGGTTCTTGATTTGGCCCGCCCACATGTCATGGGCAT
CCTCAATGTCACCCCCGATTCCTTTTCCGACGGCGGCCGTTACGACCGGCTGGACGATGCCCTGCGGCATGCCGAGCGCA
TGGTGCTGGAAGGCGCAACGCTCATCGACGTCGGCGGCGAGTCGACCCGTCCCGGTGCGCGCAGCGTTTCTCCGACGGAG
GAGCTGGAGCGGGTCGCTCCGGTAGTCGAACGCATCGCCCGCGAACTGGACGTCGTGATTTCGGTGGATACCTCCACGCC
TGCGGTCATGCGCGAAACTGCGCGTCTCGGAGCGGGTCTGATCAACGACGTCCGTTCGCTGCAGCGCGACGGTGCGTTGG
ATGCTGCGGTGGATAGCGGCCTGGCGGTCTGCCTCATGCACATGCGTGGAGAACCGCAGACCATGCAGGATGCGCCTGCC
TACCAGGATGTGGTGGCGGAAGTCGGCGCGTTCCTGCAGGAGCGTGTGGATGCCTGCGTGGCGGCCGGAATCGACCGCGA
GCGGCTGTTGCTGGATCCGGGTTTCGGTTTTGCCAAGACACTGGAGCACAACCTGGTGCTGTTCAGGCATCTGCAGGCGC
TCCATGGTCTGGGCCTGCCGTTGTTGGTCGGCGTTTCGCGCAAGAGCATGATCGGCAAGGTACTGGGGCGGGAGGTGGAC
GAACGCCTCTACGGCAGTCTCGCGCTGGCGGCCCTGGCGCTGGCCAAGGGCGCACGGATAATTCGAGTGCATGACGTGGC
GGCGACCGTCGACGTGATGCGAATGATCTCCGCCGTTGAAATGGCGGATTGA

>>MEG_2959|Drugs|Sulfonamides|Sulfonamide-resistant_dihydropteroate_synthases|FOLP|RequiresSNPConfirmation
ATGAAACTCTTTGCCCAGGGTACTTCACTGGACCTTAGCCATCCTCACGTAATGGGGATCCTCAACGTCACGCCTGATTC
CTTTTCGGATGGTGGCACGCATAACTCGCTGATAGATGCGGTGAAACATGCGAATCTGATGATCAACGCTGGCGCGACGA
TCATTGACGTTGGTGGCGAGTCCACGCGGCCAGGGGCGGCGGAAGTTAGCGTTGAAGAAGAGTTGCAACGTGTTATTCCT
GTGGTTGAGGCAATTGCTCAACGCTTCGAAGTCTGGATCTCGGTCGATACATCCAAACCAGAAGTCATCCGTGAGTCAGC
GAAAGTTGGCGCTCACATTATTAACGATATCCGCTCCCTTTCCGAACCTGGCGCTCTGGAGGCGGCTGCAGAAACCGGTT
TACCGGTTTGTCTGATGCATATGCAGGGAAATCCAAAAACCATGCAGGAAGCCCCGAAGTATGACGATGTCTTTGCAGAA
GTGAATCGCTACTTTATTGAGCAAATAGCACGTTGCGAGCAGGCGGGTATCGCAAAAGAGAAATTGTTGCTCGACCCCGG
ATTCGGTTTCGGTAAAAATCTCTCCCATAACTATTCATTACTGGCGCGCCTGGCTGAATTTCACCATTTCAACCTGCCGC
TGTTGGTGGGTATGTCACGAAAATCGATGATTGGGCAGCTGCTGAACGTGGGGCCGTCCGAGCGCCTGAGCGGTAGTCTG
GCCTGTGCGGTCATTGCCGCAATGCAAGGCGCGCACATTATTCGTGTTCATGACGTCAAAGAAACCGTAGAAGCGATGCG
AGTGGTGGAAGCTACTCTGTCTGCAAAGGAAAACAAACGCTATGAGTAA

>>MEG_2960|Drugs|Sulfonamides|Sulfonamide-resistant_dihydropteroate_synthases|FOLP|RequiresSNPConfirmation
ATGAAATTTTTTAAAATCAATCCAAACACCGATTTTAATTTGCTTTGTTCTTTCATAAACCCTCATAAAATGGGACAAAA
GATCATGAGTGAAAAAACAAAAATTCATTTTATTTTTATCAAAGATATTTCTACTCCTGCGGCAAATATTTTAAAACAAG
ATGCTTTAAGAGTAGGAGCTGAACTTATTACTCATAAAGAAGTAATTACTGCAAAAATCACTCATTCAAATGCGCTTTTA
ATGGCAAGTAAAGAGCAAATTCAAAAGCTTGTTGTCAAAGAAAAACTTCAAGATTTTGGACTTAAAAATTTGGCTCTTTT
TTTGCAAAAAGATTTTTTAAAACCGAAAAAAGCCGAGCTTATGGCAGTGATTAATGTCAATGAAGACAGTTTTAATGCAA
AAAGTCGTGTGAGTGAAGAAGACTTTGAAAAAAGGCTTAATGACTTTCTTGCTTTAAAGCCTGAATATATCGATATAGGT
GCGGTAAGCTCAAGACCTGGGAGTGAGTATTGTGGCAAGGAAGAGGAATTTAAAAGACTGAAAAAAGTACTTGACTTAAT
TTATGAGAAAAATTATTACGAACAAGCAATTTTTAGTTTAGATAGTTTTGATGAATATTGTCTAGAATATGCTTTAAATA
AGGGTTTTAAACTCATTAATGATATTACAAGTTTAAGAAATCTTAATCTAGCCAAACTTGCAAGTAAATATGGGGCAAAA
TATTGCTTAATGCACATGCAAAACAATCCAAATAACATGCAAGATAATCCTTTTTATGAAGATTTGCTTGATGAGATGAC
TTTGTTTTTTAAAGAAAAACTTGAGCTTTTAGAAAGTTTTGGAGTAAAAGAAAGTATTTTAGATGTAGGTATTGGTTTTG
GAAAGAGTGCGGGGCATAATATGATTTTAATCAAACACTTAGAACATTTTTTGCAATTTAATAAACCTTTACTTATAGGT
GCGAGTCGTAAAAGTGTGATTAATGCGTATTTTCAAAGCGAGATTAAAGATCGTTTAGCGGGAACTTTATATTTGCATTT
AAAGGCTTTTGAAAATGGTGCTAGTATTATAAGAGTGCATGATTTATATGAGCATAAACAACTTTTTGCTTTAGCGCAGG
CAATGGATAATATAGGAGTTTAG

>>MEG_2961|Drugs|Sulfonamides|Sulfonamide-resistant_dihydropteroate_synthases|FOLP|RequiresSNPConfirmation
ATGCAGTTAATATCTTTACCAAAGCAGATTTTACAGTGTGGACAGCTTCAATTAGATTTATCTCAGCCCCATGTTATGGG
TATCTTAAATGTCACTCCTGATTCTTTCAGTGATGGTGGTAAACATAACCAATTAGACCAAGCGGTTGATCATGCACTTA
GTATGATTGAGCAAGGCGCGACTATTATTGATATTGGGGGGGAATCTACCCGACCTGGTGCTTCAGAAGTTGTAGTAGAA
GAAGAAGTGCGTCGTGTGGTACCTGTGGTCGAGGCTTTATCTTACCATAACGTTATTTTGTCGATCGACACAAGTCAGCC
AGAAGTTATTCGCGCAGCAAAAGCAGCAGGGGCACATATCTGGAATGATGTCCGTGCCTTAACACGTCCCAATGCTTTAA
AAACTGCCGTAGAATTAGATATACCTGTAGTAATTATGCATATGCGCGGTGAACCAACGACAATGAATCAGTTGGATCAG
TACACTGATGTAACACTCGATGTGATGCAAGAGTTGCAACAGCGTATTGATGAGGCTTTGGCTGCTGGGGTAAAAAAGCA
CAATATTATTGTTGATCCTGGATTTGGCTTTGCGAAAAATGCCCAGCAAAATTTAAAACTATTAAAAGAATTTTGGAAAC
TTAATGAACTTGGTTATCCAATTTTATCCGGGCTTTCTCGTAAACGTTTCATAGGTGAAGCTTTACAAGGTGTTCCTGCA
GATCAACGTGCTGTGGGAAGTGTAACTGGGCATTTGCTTAGTATTCAGCAGGGAGCATCCATTGTAAGAGCGCATGATGT
AAAGGAAATGCATGAAGCAATTTTAGTTTGGAAAGCTATGCAGCAAGCCTAA

>>MEG_2962|Drugs|Sulfonamides|Sulfonamide-resistant_dihydropteroate_synthases|FOLP|RequiresSNPConfirmation
ATGACTAAAACAAAAATTATGGGCATATTAAACGTCACACCTGATTCATTCTCAGATGGTGGAAAATTTAATAATGTTGA
ATCAGCTATAAATAGAGTGAAAGCCATGATAGATGAAGGTGCTGACATTATAGATGTTGGAGGTGTTTCAACGAGACCCG
GTCATGAAATGGTTTCATTAGAAGAAGAGATGAACAGAGTATTACCTGTTGTTGAAGCTATTGTCGGTTTTGATGTAAAA
ATTTCAGTCGATACATTTCGAAGTGAGGTTGCTGAAGCATGTTTAAAATTAGGCGTTGATATGATTAATGATCAATGGGC
GGGTCTGTATGATCATCGTATGTTCCAAATTGTAGCTAAATATGACGCGGAAATTATTTTAATGCATAATGGAAATGGTA
ATCGTGATGAACCGGTTGTCGAAGAAATGTTAACATCTTTGTTAGCACAAGCACATCAAGCTAAAATAGCTGGTATACCT
TCAAATAAAATTTGGCTAGATCCAGGTATAGGTTTCGCTAAAACTAGAAATGAAGAAGCCGAAGTTATGGCAAGACTGGA
TGAACTTGTTGCAACAGAATATCCAGTTTTATTAGCGACAAGCCGGAAACGTTTCACTAAAGAGATGATGGGTTATGATA
CAACACCGGTTGAAAGAGATGAAGTAACTGCAGCTACGACTGCATATGGTATTATGAAAGGCGTTAGAGCAGTACGCGTT
CATAATGTCGAGTTGAATGCTAAATTAGCTAAAGGTATAGATTTTTTAAAGGAGAATGAAAATGCAAGACACAATCTTTC
TTAA

>>MEG_2963|Drugs|Sulfonamides|Sulfonamide-resistant_dihydropteroate_synthases|FOLP|RequiresSNPConfirmation
GTGTCATTAATTGTGTTTGATTATGGTAAAAGAACTTATATAATGGGAATATTAAATGTAACTCCAGATAGTTTTTCTGA
TGGAGGAGATTTTAATAACTTGGACATAGCAATACAACATGCAAAAGATATGGTTGACCAAGGTGCAGATATAATAGACC
TAGGAGGAGAGTCTACACGCCCAGGTCATAGCTATGTAGACTCAGACGAAGAGCTAAGAAGAGTAATCCCTGTAATAAAA
AAACTTAAACAGGAATTGGATATACCAATATCAATAGACACTTATAAGGCAGATGTTGCAGAAGAAGCATTAAAATTAGG
TGTCACTATGGTAAATGATGTTTGGGGTCTTAGAAAAGATAAAAATATGGCTTCTGTAATAGGAAAATATGATGCAGAAG
TGTGTATAATGCATAATCAAGATGGGACAAACTATGACAAAGATATAATGGAGTCAATAAAAGACTTTTTTAAGGTAAGT
ATAGAAATGGCAATGAGTTGTGGTGTAAAAAAAGAAAAAATAGTACTTGACCCAGGTGTAGGATTTGGCAAGGATTTTGA
ACAAAATATTGAAGTATTGAGAAGATTAAATGAATTAAAAGATTTAGGGTATCCTATTTTGCTTGGGACATCCAGAAAAT
CAGTAATAGGAAAAGTACTTCCAGTTGAGCCTAAAAAAAGATTAGAAGGTACAATAGCTACTACTGTTCTTGGTATAAGA
GATGGCGTAGATATAGTTAGAGTACATGATGTTTATGAAAATTTAATGGCAGCTAGAATGACTGATGCAATATATAGAAA
GTAG

>>MEG_2964|Drugs|Sulfonamides|Sulfonamide-resistant_dihydropteroate_synthases|FOLP|RequiresSNPConfirmation
GTGGAAGTCGCCAATGTGCCACGGCGTCATTGCTGCCTTTTTGCTCGCCCGATCCCCATCGTGGAAGTCGCTGCGGAGGC
CGACGCCATGGTGACGGTGTTCGGCATTCTGAATCTCACCGAGGACTCCTTCTTCGATGAGAGCCGGCGGCTAGACCCCG
CCGGCGCTGTCACCGCGGCGATCGAAATGCTGCGAGTCGGATCAGACGTCGTGGATGTCGGACCGGCCGCCAGCCATCCG
GACGCGAGGCCTGTATCGCCGGCCGATGAGATCAGACGTATTGCGCCGCTCTTAGACGCCCTGTCCGATCAGATGCACCG
TGTTTCAATCGACAGCTTCCAACCGGAAACCCAGCGCTATGCGCTCAAGCGCGGCGTGGGCTACCTGAACGATATCCAAG
GATTTCCTGACCCTGCGCTCTATCCCGATATTGCTGAGGCGGACTGCAGGCTGGTGGTTATGCACTCAGCGCAGCGGGAT
GGCATCGCCACCCGCACCGGTCACCTTCGACCCGAAGACGCGCTCGACGAGATTGTGCGGTTCTTCGAGGCGCGGGTTTC
CGCCTTGCGACGGAGCGGGGTCGCTGCCGACCGGCTCATCCTCGATCCGGGGATGGGATTTTTCTTGAGCCCCGCACCGG
AAACATCGCTGCACGTGCTGTCGAACCTTCAAAAGCTGAAGTCGGCGTTGGGGCTTCCGCTATTGGTCTCGGTGTCGCGG
AAATCCTTCTTGGGCGCCACCGTTGGCCTTCCTGTAAAGGATCTGGGTCCAGCGAGCCTTGCGGCGGAACTTCACGCGAT
CGGCAATGGCGCTGACTACGTCCGCACCCACGCGCCTGGAGATCTGCGAAGCGCAATCACCTTCTCGGAAACCCTCGCGA
AATTTCGCAGTCGCGACGCCAGAGACCGAGGGTTAGATCATGCCTAG

>>MEG_2965|Drugs|Sulfonamides|Sulfonamide-resistant_dihydropteroate_synthases|FOLP|RequiresSNPConfirmation
ATGGCAAATAACTTCCAGTGCGGGCGCTTTGAGTTCGATCTCGAGCGCCCGCTTGTCATGGGCATCGTCAACGTCACGCC
CGACTCGTTTTCCGATGGCGGCGAGCACGCCGATACCGACAGCGCGATCGCCCACGCGCGCCAATTGATCGACGAAGGGG
CCCATATCCTGGACCTGGGCGGCGAATCGACGCGGCCGGGCGCGCAGCCGGTCAGCGCGGCCGACGAGCTGGCGCGCATC
CTGCCGCTGATCGAAGGGCTGCGCGACTGCGGCGTGCCGTTGTCGATCGACACCTTCAAGCCCGAGGTCATGCGCGCCGT
GCTTGACGCCGGCGCCGACATGATCAACGACATCTACGGTTTCCGGCAGCCCGGCGCCATCGACGCGGTGGCGCGCTCGC
GCTGCGGCCTGTGCGTCATGCACATGAAGGGCGAGCCGCGCACCATGCAGGAGGCGCCCGAGTACGCCGACCTGATGGGC
GAAATCGGGGTCTTCCTGGGCGCGCGCGCCCAGCGGCTGCGCGCCGCGTGGGTCGACCCCCGGCGCATCGTGCTGGACCC
GGGCTTCGGGTTCGGCAAGACCATGGATCAGAATTATCAGTTGCTGCGCCGCCTGGCCAGCTTGCGCGTCTCCAGCTACC
CCCTGCTGGTGGGCGTCTCGCGCAAATCCATGATAGGCGCGGCCACCGGCAAGCCGGTGGGCGACCGCCTGGCCGGCAGC
GTTGCCGCCGCGCTGGCATGCGTGGCGCGCGGCGCCGCCATCGTGCGTGTGCACGATGTCGCCGCGACCGTGGATGCGCT
AAAAGTGTGGCAGGCGGCCGAACAAGGAGCAGTCCCTACATGA

>>MEG_2966|Drugs|Sulfonamides|Sulfonamide-resistant_dihydropteroate_synthases|FOLP|RequiresSNPConfirmation
ATGAAACTCTTCGCTCAGGGCGCCACGCTCGATCTCACTCATCCGCATGTTATGGGGATCCTGAACGTAACGCCGGATTC
GTTCTCCGACGGCGGCGCGCATAACACGCTGATTGAGGCGGTGAAACATGCGAATTTAATGGTGAATGCCGGGGCGACAA
TTATTGATGTGGGGGGGGAATCAACGCGACCAGGCGCGGCAGAAGTGAGCGTGGAAGAAGAGCTGGATCGCGTTATTCCG
GTACTGGAAGCAATCGCGCAACGTTTTGAAGTGTGGATTTCTGTGGATACCTCTAAACCCGAGGTGATCCGTGAAGCGGC
AAGGGCGGGCGCGCATATTATCAATGATGTCCGTTCACTCTCCGAACCCGGCGCGTTGGAAGCGGCAGCGGAAACCGGCT
TGCCGGTCAGTCTTATGCACATGCAGGGCAACCCCAAAACCATGCAGGAGGCGCCGAAATATGACGATGTCTTTGCCGAG
GTGAATCGCTACTTTATTGAGCAAATAGCACGTTGTGAGAAGGCCGGCATCGCAAAAGAGAAATTGTTGCTCGACCCAGG
ATTCGGTTTCGGTAAAAATCTCTCTCACAATTATACCTTACTGGCGCGACTGGGTGAGTTTCATCATTTTAACCTGCCGC
TGCTGGTGGGCATGTCACGTAAAACGATGGTTGGTCAGTTACTTAACGTGGGACCATCAGACCGTCTGAACGGCAGCCTT
GCGTGCGCGGTAATTGCCGCGATGCAGGGCGCGCAGATCATTCGCGTCCATGACGTCAAAGAAACCGTAGAGGCGATGCG
GGTGGTGGAAGCCACTCTGTCTGCAAAGGGAAACAAACGCTATGAGTAA

>>MEG_2967|Drugs|Sulfonamides|Sulfonamide-resistant_dihydropteroate_synthases|FOLP|RequiresSNPConfirmation
ATGGCGCAGCACACAATAGATCAAACACAAGTAATCCACACTAAGCCCAGCGCTTTATCATATAAAGAGAAGACGCTGGT
GATGGGAATTTTAAACGTAACGCCTGACTCTTTCTCGGACGGCGGAAAATATGACAGCTTGGACAAGGCGCTGCTGCACG
CGAAAGAGATGATCGATGATGGTGCCCATATCATTGATATTGGAGGGGAATCGACAAGGCCTGGCGCTGAGTGCGTATCT
GAGGATGAGGAGATGTCCAGAGTCATTCCGGTGATTGAGCGGATTACGAAAGAGCTTGGTGTTCCTATTTCTGTAGACAC
GTACAAGGCTTCTGTCGCAGATGAAGCAGTGAAAGCCGGTGCATCCATTATCAATGATATTTGGGGAGCCAAACATGATC
CGAAGATGGCTTCCGTTGCAGCTGAACATAATGTTCCAATTGTACTCATGCATAACCGCCCTGAAAGAAACTACAATGAC
TTATTGCCGGATATGCTGTCGGACTTAATGGAGAGTGTAAAAATTGCTGTTGAGGCCGGAGTAGACGAGAAGAACATTAT
TCTTGATCCTGGTATCGGTTTCGCGAAAACCTATCACGATAACTTGGCAGTGATGAACAAACTAGAGATTTTCAGCGGAT
TGGGATATCCGGTTCTTCTGGCAACCTCCCGAAAAAGATTCATCGGACGTGTTCTGGATCTTCCGCCTGAGGAGCGGGCT
GAGGGCACAGGCGCGACTGTGTGTCTCGGCATTCAAAAAGGCTGTGACATTGTCAGGGTCCATGATGTAAAGCAAATTGC
CAGAATGGCGAAAATGATGGACGCGATGCTGAATAAGGGAGGGGTGCACCATGGATAA

>>MEG_2968|Drugs|Sulfonamides|Sulfonamide-resistant_dihydropteroate_synthases|FOLP|RequiresSNPConfirmation
ATGACTAAAACAAAAATTATGGGCATATTAAACGTCACACCTGATTCATTCTCAGATGGTGGAAAATTTAATAATGTTGA
AACAGCTATAAATAGAGTGAAAGCCATGATAGATGAAGGTGCTGACATTATAGATGTTGGAGGTGTTTCAACGAGACCCG
GTCATGAAATGGTTACATTAGAAGAAGAGCTGAACAGAGTATTACCTGTTGTTGAAGCTATTGTCGGTTTTGATGTAAAA
ATTTCAGTCGATACATTTCGAAGTGAGGTTGCTGAAGCATGTTTAAAATTAGGCGTTGATATGATTAATGATCAATGGGC
GGGTCTGTATGATCATCGTATGTTCCAAATTGTAGCTAAATATGACGCGGAAATTATTTTAATGCATAATGGAAATGGTA
ATCGTGATGAACCGGTTGTCGAAGAAATGTTAACATCTTTGTTAGCACAAGCACATCAAGCTAAAATAGCTGGTATACCT
TCAAATAAAATTTGGCTAGATCCAGGTATAGGTTTCGCTAAAACTAGAAATGAAGAAGCCGAAGTTATGGCAAGACTGGA
TGAACTTGTTGCAACAGAATATCCAGTTTTATTAGCGACAAGCCGGAAACGTTTCACTAAAGAGATGATGGGTTATGATA
CAACACCGGTTGAAAGAGATGAAGTAACTGCAGCTACGACTGCATATGGTATTATGAAAGGCGTTAGAGCAGTACGCGTT
CATAATGTCGAGTTGAATGCTAAATTAGCTAAAGGTATAGATTTTTTAAAGGAGAATGAAAATGCAAGACACAATCTTTC
TTAA

>>MEG_2969|Drugs|Sulfonamides|Sulfonamide-resistant_dihydropteroate_synthases|FOLP|RequiresSNPConfirmation
GTGCGTTCAACACCGCCGGCCTCAGCCGGTCGTTCAACACCGCCGGCGTTAGCCGGCCATTCAACACCGCCGGCGTTAGC
CGGCCATTCAACGCTGTGCGGCCGTCCAGTCGCAGGTGATCGTGCGCTGATCATGGCGATCGTCAACCGCACCCCGGATT
CGTTTTACGACAAGGGTGCGACTTTCAGCGACGCGGCTGCCAGAGACGCGGTCCACCGGGCCGTCGCCGACGGTGCCGAC
GTCATCGACGTCGGCGGTGTCAAAGCCGGCCCGGGTGAACGCGTCGACGTCGACACCGAGATCACGCGGCTGGTGCCGTT
CATCGAATGGCTCCGCGGTGCTTACCCGGACCAGCTGATCAGTGTCGACACCTGGCGCGCGCAGGTGGCGAAGGCGGCCT
GCGCGGCGGGGGCGGACCTGATCAACGACACCTGGGGTGGCGTCGACCCGGCCATGCCCGAGGTGGCCGCCGAGTTCGGC
GCGGGCCTGGTGTGTGCGCACACCGGCGGCGCGCTGCCACGCACGCGACCCTTCCGGGTGAGCTACGGTACGACTACCCG
CGGTGTGGTGGATGCTGTGATTAGCCAGGTCACAGCCGCCGCCGAGCGGGCCGTCGCGGCCGGGGTGGCCCGCGAGAAGG
TGTTGATCGACCCGGCACACGACTTCGGCAAGAACACCTTCCATGGGCTGCTGCTATTGCGACACGTGGCCGATCTTGTT
ATGACCGGGTGGCCCGTGCTGATGGCTTTGAGCAACAAGGACGTTGTCGGGGAGACTCTGGGCGTGGATTTGACCGAACG
GCTTGAGGGAACGCTGGCAGCCACCGCGTTGGCTGCGGCCGCCGGGGCGCGCATGTTTCGGGTGCATGAGGTCGCCGCCA
CCCGGCGGGTGCTGGAAATGGTGGCATCGATTCAGGGGGTCCGGCCGCCGACGCGCACGGTGAGAGGACTCGCATGA

>>MEG_2970|Drugs|Sulfonamides|Sulfonamide-resistant_dihydropteroate_synthases|FOLP|RequiresSNPConfirmation
ATGGGGGTTCTAAACGTCACGGACGACTCTTTCTCGGACGGCGGGTGTTATCTCGATCTCGACGATGCGGTGAAGCACGG
TCTGGCGATGGCAGCCGCAGGTGCGGGCATCGTCGACGTCGGTGGTGAGTCGAGCCGGCCCGGTGCCACTCGGGTTGACC
CGGCGGTGGAGACGTCTCGTGTCATACCCGTCGTCAAAGAGCTTGCAGCACAAGGCATCACCGTCAGCATCGATACCATG
CGCGCGGATGTCGCTCGGGCGGCGTTGCAGAACGGTGCCCAGATGGTCAACGACGTGTCGGGTGGGCGGGCCGATCCGGC
GATGGGGCCGCTGTTGGCCGAGGCCGATGTGCCGTGGGTGTTGATGCACTGGCGGGCGGTATCGGCCGATACCCCGCATG
TGCCTGTGCGCTACGGCAACGTGGTGGCCGAGGTCCGTGCCGACCTGCTGGCCAGCGTCGCCGACGCGGTGGCCGCAGGC
GTCGACCCGGCAAGGCTGGTGCTCGATCCCGGGCTTGGATTCGCCAAGACGGCGCAACATAATTGGGCGATCTTGCATGC
CCTTCCGGAACTGGTCGCGACCGGAATCCCAGTGCTGGTGGGTGCTTCGCGCAAGCGCTTCCTCGGTGCGTTGTTGGCCG
GGCCCGACGGCGTGATGCGGCCAACCGATGGGCGTGACACCGCGACGGCGGTGATTTCCGCGCTGGCCGCACTGCACGGG
GCCTGGGGTGTGCGGGTGCATGATGTGCGGGCCTCGGTCGATGCCATCAAGGTGGTCGAAGCGTGGATGGGAGCGGAAAG
GATAGAACGCGATGGCTGA

>>MEG_2971|Drugs|Sulfonamides|Sulfonamide-resistant_dihydropteroate_synthases|FOLP|RequiresSNPConfirmation
GTGAGTCCGGCGCCCGTGCAGGTGATGGGGGTTCTAAACGTCACGGACGACTCTTTCTCGGACGGCGGGTGTTATCTCGA
TCTCGACGATGCGGTGAAGCACGGTCTGGCGATGGCAGCCGCAGGTGCGGGCATCGTCGACGTCGGTGGTGAGTCGAGCC
GGCCCGGTGCCACTCGGGTTGACCCGGCGGTGGAGACGTCTCGTGTCATACCCGTCGTCAAAGAGCTTGCAGCACAAGGC
ATCACCGTCAGCATCGATACCATGCGCGCGGATGTCGCTCGGGCGGCGTTGCAGAACGGTGCCCAGATGGTCAACGACGT
GTCGGGTGGGCGGGCCGATCCGGCGATGGGGCCGCTGTTGGCCGAGGCCGATGTGCCGTGGGTGTTGATGCACTGGCGGG
CGGTATCGGCCGATACCCCGCATGTGCCTGTGCGCTACGGCAACGTGGTGGCCGAGGTCCGTGCCGACCTGCTGGCCAGC
GTCGCCGACGCGGTGGCCGCAGGCGTCGACCCGGCAAGGCTGGTGCTCGATCCCGGGCTTGGATTCGCCAAGACGGCGCA
ACATAATTGGGCGATCTTGCATGCCCTTCCGGAACTGGTCGCGACCGGAATCCCAGTGCTGGTGGGTGCTTCGCGCAAGC
GCTTCCTCGGTGCGTTGTTGGCCGGGCCCGACGGCGTGATGCGGCCAACCGATGGGCGTGACACCGCGACGGCGGTGATT
TCCGCGCTGGCCGCACTGCACGGGGCCTGGGGTGTGCGGGTGCATGATGTGCGGGCCTCGGTCGATGCCATCAAGGTGGT
CGAAGCGTGGATGGGAGCGGAAAGGATAGAACGCGATGGCTGA

>>MEG_2972|Drugs|Sulfonamides|Sulfonamide-resistant_dihydropteroate_synthases|FOLP|RequiresSNPConfirmation
ATGAAACTCTTTGCCCAGGGTACTTCACTGGACCTTAGCCATCCTCACGTAATGGGGATCCTCAACGTCACGCCTGATTC
CTTTTCGGATGGTGGCACGCATAACTCGCTGATAGATGCGGTGAAACATGCGAATCTGATGATCAACGCTGGCGCGACGA
TCATTGACGTTGGTGGCGAGTCCACGCGCCCAGGGGCGGCGGAAGTTAGCGTTGAAGAAGAGTTGCAACGTGTTATTCCT
GTGGTTGAGGCAATTGCTCAACGCTTCGAAGTCTGGATCTCAGTCGATACATCCAAACCAGAAGTCATCCGTGAGTCAGC
GAAAGTTGGCGCTCACATTATTAATGATATCCGCTCCCTTTCCGAACCTGGCGCTCTGGAGGCGGCTGCAGAAACCGGTT
TACCGGTTTGTCTGATGCATATGCAGGGAAATCCAAAAACCATGCAGGAAGCTCCGAAGTATGACGATGTCTTTGCAGAA
GTGAATCGCTACTTTATTGAGCAAATAGCACGTTGCGAGCAGGCGGGTATCGCAAAAGAGAAATTGTTGCTCGACCCCGG
ATTCGGTTTCGGTAAAAATCTCTCCCATAACTATTCATTACTGGCGCGCCTGGCTGAATTTCACCATTTCAACCTGCCGC
TGTTGGTGGGTATGTCACGAAAATCGATGATTGGGCAGCTGCTGAACGTGGGGCCGTCCGAGCGCCTGAGCGGTAGTCTG
GCCTGTGCGGTCATTGCCGCAATGCAAGGCGCGCACATCATTCGTGTTCATGACGTCAAAGAAACCGTAGAAGCGATGCG
GGTGGTGGAAGCCACTCTGTCTGCAAAGGAAAACAAACGCTATGAGTAA