MEGAResFrom MEG, the Microbial Ecology Group

Notice: Trying to access array offset on value of type null in /home/meglabuser/megares.meglab.org/vendor/doctrine/annotations/lib/Doctrine/Common/Annotations/DocParser.php on line 967

RGT

The rgt gene encodes a rifampin glycosyltransferase.

References

  • http://www.ncbi.nlm.nih.gov/pubmed/22802246

Notice: Trying to access array offset on value of type null in /home/meglabuser/megares.meglab.org/vendor/doctrine/annotations/lib/Doctrine/Common/Annotations/DocParser.php on line 967

Sequences

Download Sequences

>>MEG_6054|Drugs|Rifampin|Rifampin_glycosyltransferase|RGT
ATGCGCATGCTGCTGACCACGTACGGATCGCGCGGAGATGTCGAGCCGCTGGCCGGACTCGCGGCGGGATTGCGAAAGTT
GGGCGTGGAGGCGCGGGTGTGCGCGCCGCCGGACGAGGAGTTCGCGGCGTTGCCGGCGCGTGCGGGCGTTCCGCTGATTC
CGCTCGGCCCGCCGGTGCGTCCGGTGGTGGCCGGTGAGCGGCCACCGACACCTCAGGACGCCTTCCGGCTCGCCGCCGAA
CTGGTCACCGCCCGCTTCGACACGCTCACCGAGGCGGCCGAGGGTTGTCAGGCGGTGCTGGCCACGGGGTTGATGCCGGC
CGGTGTCCGCGACGTGGCCGAGAAGCTGGGGATTCCCTACGTCTTCGCCTGCTTCCACATCTACGGGCTGCCGTCGCGGC
ACTTTCCTCCGGGCGCGCGTCCGGGCACCCCGCCCGCACCGGACGGGACCGACCACCGGGAGTTGTGGGAACAGGACGCC
CGGAGCGTGAACGCGCTGTACGGCGACGCCCTCAACCGTCACCGCACCGGGATCGGCCTGCCGCCCGTGCGGAACGTCCG
GGACCACGTCCTCACCGACCGGCCGTGGCTCGCAGCGGACCCGGTGCTGTGTCCCGCGGAGGGGATGACGGAGTTCGACC
TCGTACAGACCGGACCGTGGTTCCTGCCGGACGAACGTCCGCTGCCCGCCGGGCTGGAGGAGTTCCTCGGCGCCGGGGCA
CCACCGGTGTACGTGGGCTTCGGCAGCATGGGCGCCTACGCTCCGGAGGGCATCGCCCGGGTGGCCGTCGAAGCCTGCCG
TGCGCAGGGGCGCCGTGTGGTCCTCGCTCGCGGGTGGGCCGGGCTGACTCCGGACGACGGCGGTGCCGACTGCTTCGCGG
TCGGCGAGGTCAACCAGCAGGCGCTGTTCCGCCGGGTGGCCGCCGTGGTGCACCACGGCGGGGCGGGGACCACGACGACG
GCCGCCCGCGCGGGGGCGCCCCAGGTGGTGGTTCCGAGGATCGCGGACCAGCCGTACTGGGCCGAGAGGGTGAGGGACCT
CGGCATCGGCTCGGCTCATCCCGACCCGGTGGTGACCTTCGACTCCCTGTCCGCCGCGCTGACGACGGCTCTGGCACCCG
AAGTCCGGGCACGGGCACGGACGGTGGCGGGCACCATCCGCACGGACGGTGCCTCGGTGGCCGCGCGGCTCCTCGTCGAG
ACCGCCGACCGGGCGGGGCGGCCGGTGTCCCCGTGA