MEGAResFrom MEG, the Microbial Ecology Group

Notice: Trying to access array offset on value of type null in /home/meglabuser/megares.meglab.org/vendor/doctrine/annotations/lib/Doctrine/Common/Annotations/DocParser.php on line 967

EMEA

The emeA gene encodes a norA homolog multi-drug efflux pump in Entercoccus faecalis.

References

  • http://www.ncbi.nlm.nih.gov/pubmed/11709342

Notice: Trying to access array offset on value of type null in /home/meglabuser/megares.meglab.org/vendor/doctrine/annotations/lib/Doctrine/Common/Annotations/DocParser.php on line 967

Sequences

Download Sequences

>>MEG_2714|Biocides|Quaternary_Ammonium_Compounds_(QACs)_resistance|QAC_efflux_pump|EMEA
ATGACGAAAAAAAATAGTATGATGTACTTAGCAATTTCTAACTTATTTCTTGTTTTTCTAGGCGTAGGCCTAGTCATTCC
CGTAATTCCCCAATTAAAAGAAGAAATGCATTTTTCTGGTACCACAATGGGAATGATGATTTCTATTTTTGCGATTGCCC
AATTAATCACATCGCCAATCGCAGGTGTCCTTTCGGATAAAATTGGTCGGAAAAAAATGATTGCGACGGGCATGTTGGTG
TTTTCAATTTCTGAGTTATTATTTGGTTTAGCCCAAGCGAAAAGCGGTTTTTATATTTCTCGTGGTTTAGGTGGGATTGC
CGCCGCGTTATTAATGCCGTCAGTGACAGCCTTTGTGGCAGATATGACCACGATTTCTGAACGTCCGAAAGCGATGGGGC
TTGTGTCAGCTGCAATTAGTGGTGGTTTTATTATCGGACCAGGAGTTGGTGGTTTTATTATCGGACCAGGAGTTGGTGGT
TTTATTGCTTATTTAGGAATTCGCGCTCCATTTTTTGCGGCCGCATTTTTAGCGTTTATTGGTTTTATTTTGACATTAAC
TGTTTTGAAGGAGCCAGAGAAACGAATTTTAGCCGCTGTTGAAGCGAAAAAAGGTTCATTTATGGATATTTTAAGAAATC
CAATGTTTACCTCATTATTTGTGATTATCTTAATTTCCTCTTTTGGCCTGCAAGCGTTCGAATCTATTTATAGTATTATG
GCGACCATTAATTTTGGCTTTACCACAAGTGAAATAGCAATCGTGATTACGGTTAGTGGTATTTTAGCGTTGATTTGTCA
GCTGTTTTTCTTTGATGCAATCGTCCAAAAAATAGGTGAAATGGGTTTAATCCAATTAACCTTTTTTGCAAGTGCCATTT
TTATTGCCGTGATTGCCTTTACAAAAAATAATTTAGTTGTTGTATTTTCAACGTTTATTGTCTTTTTAGCGTTTGACTTG
TTTAGACCAGCAGTAACTACTTATTTATCCAAACATGCTGGAGATCAACAAGGAACCATCAACGGACTAAATTCGACATT
TACAAGTTTTGGTAATATTTTAGGACCAATGGCAGCAGGAGCTTTATTTGATATCAATCACTTTTTCCCTTATTATGTTT
CAGCAGTAATTCTGTTAGGAACGGGCTTTTTATCGTTATTTTTAAATCGAAATAAGATGTAA