MEGAResFrom MEG, the Microbial Ecology Group

Notice: Trying to access array offset on value of type null in /home/meglabuser/megares.meglab.org/vendor/doctrine/annotations/lib/Doctrine/Common/Annotations/DocParser.php on line 967

FABG

The FABG group of genes confer resistance to Triclosan through the mechanism, Triclosan-resistant mutation.

References


    Notice: Trying to access array offset on value of type null in /home/meglabuser/megares.meglab.org/vendor/doctrine/annotations/lib/Doctrine/Common/Annotations/DocParser.php on line 967

    Sequences

    Download Sequences

    >>MEG_2873|Biocides|Phenolic_compound_resistance|Triclosan-resistant_mutation|FABG|RequiresSNPConfirmation
    ATGAATTTTGAAGGAAAAATCGCACTGGTAACCGGTGCAAGCCGCGGAATTGGCCGCGCAATTGCTGAAACGCTCGCAGC
    CCGTGGCGCGAAAGTTATTGGCACTGCGACCAGTGAAAATGGCGCTCAGGCGATCAGTGATTATTTAGGTGCCAACGGCA
    AAGGTCTGATGTTGAATGTGACCGACCCGGCATCTATCGAATCTGTTCTGGAAAAAATTCGCGCAGAATTTGGTGAAGTG
    GATATCCTGGTCAATAATGCCGGTATCACTCGTGATAACCTGTTAATGCGAATGAAAGATGAAGAGTGGAACGATATTAT
    CGAAACCAACCTTTCATCTGTTTTCCGTCTGTCAAAAGCGGTAATGCGCGCTATGATGAAAAAGCGTCATGGTCGTATTA
    TCACTATCGGTTCTGTGGTTGGTACCATGGGAAATGGCGGTCAGGCCAACTACGCTGCGGCGAAAGCGGGCTTGATCGGC
    TTCAGTAAATCACTGGCGCGCGAAGTTGCGTCACGCGGTATTACTGTAAACGTTGTTGCTCCGGGCTTTATTGAAACGGA
    CATGACACGTGCGCTGAGCGATGACCAGCGTGCGGGTATCCTGGCGCAGGTTCCTGCGGGTCGCCTCGGCGGCGCACAGG
    AAATCGCCAACGCGGTTGCATTCCTGGCATCCGACGAAGCAGCTTACATCACGGGTGAAACTTTGCATGTGAACGGCGGG
    ATGTACATGGTCTGA