MEGAResFrom MEG, the Microbial Ecology Group

Notice: Trying to access array offset on value of type null in /home/meglabuser/megares.meglab.org/vendor/doctrine/annotations/lib/Doctrine/Common/Annotations/DocParser.php on line 967

CATB

The cat genes encode chloramphenicol acetyltransferases. Upregulation of the transcription of this gene is induced by the presence of chloramphenicol, and the gene is usually found on a plasmid.

References

  • http://www.ncbi.nlm.nih.gov/pubmed/6340955

Notice: Trying to access array offset on value of type null in /home/meglabuser/megares.meglab.org/vendor/doctrine/annotations/lib/Doctrine/Common/Annotations/DocParser.php on line 967

Other Groups in Chloramphenicol acetyltransferases

Sequences

Download Sequences

>>MEG_1594|Drugs|Phenicol|Chloramphenicol_acetyltransferases|CATB|RequiresSNPConfirmation
atgaaaaactactttaacagccctttcaaaggggaacttctttctgagcaagtgaaaaatccaaatatcagagtaggccg
gtatagctattactctggctactatcacgggcactcatttgatgaatgcgcgcgatacttgcttccagatcgtgatgacg
ttgataaattgatcattggcagcttttgttctataggaagcggggcttccttcatcatggctggcaatcaggggcatcgg
catgactgggcatcatccttccccttcttctatatgcaagaggagcctgctttctcaagagcactcgacgccttccaaag
agcaggtgataccgtcattggcaatgatgtctggataggctcggaggcaatgattatgcctggcatcaaaattggagacg
gtgccgtgataggtagtcgcccgttggtgacaaaagatgtagagccttatgccatcatcgggggaaatcccgcaaagcaa
attaagaagcgcttctccgatgaggaaatctcattgctcatggagatggagtggtggaactggccactagataaaattaa
gacagcaatgcctctgctgtgctcgtcaaatatttttggtctgcataagtattggcgcgagtttgccgtctaa

>>MEG_1595|Drugs|Phenicol|Chloramphenicol_acetyltransferases|CATB|RequiresSNPConfirmation
atgaaaaactactttaacagccctttcaaaggggaacttctttctgagcaagtgaaaaatccaaatatcagagtaggccg
gtatagctattactctggctactatcacgggcactcatttgatgaatgcgcgcgatacttgcttccagatcgtgatgacg
ttgataaattgatcattggcagcttttgttctataggaagcggggcttccttcatcatggctggcaatcaggggcatcgg
catgactgggcatcatccttccccttcttctatatgcaagaggagcctgctttctcaagagcactcgacgccttccaaag
agcaggtgataccgtcattggcaatgatgtctggataggctcggaggcaatgattatgcctggcatcaaaattggagacg
gtgccgtgataggtagtcgctcgttggtgacaaaagatgtagagccttatgccatcatcgggggaaatcccgcaaagcat
attaagaagcgcttctccgatgaggaaatctcattgctcatggagatggagtggtggaactggccactagataaaattaa
gacagcaatgcctctgctgtgctcgtcaaatatttttggtctgcataagtattggcgcgagtttgccgtctaa

>>MEG_1596|Drugs|Phenicol|Chloramphenicol_acetyltransferases|CATB|RequiresSNPConfirmation
atgaaaaactactttaacagccctttcaaaggggaacttctttctgagcaagtgaaaaatccaaatatcagagtaggccg
gtatagctattactctggctactatcacgggcactcatttgatgaatgcgcgcgatacttgcttccagatcgtgatgacg
ttgataaattgatcattggcagcttttgttctataggaagcggggcttccttcatcatggctggcaatcaggggcatcgg
catgactgggcatcatccttccccttcttctatatgcaaggggagcctgctttctcaagcgcactcgacgccttccaaag
agcaggtgataccgtcattggcaatgatgtctggataggctcggaggcaatgattatgcctggcatcaaaattggagacg
gtgccgtgataggtagtcgctcgttggtgacaaaagatgtagagccttatgccatcatcgggggaaatcccgcaaagcaa
attaagaagcgcttctccgatgaggaaatctcattgctcatggagatggagtggtggaactggccactagataaaattaa
gacagcaatgcctctgctgtgctcgtcaaatatttttggtctgcataagtattggcgcgagtttgccgtctaa

>>MEG_1597|Drugs|Phenicol|Chloramphenicol_acetyltransferases|CATB|RequiresSNPConfirmation
atgaaaaactactttgacagccctttcaaaggggaactactttctgagcaagtgaaaaatcaaaatatcagagtaggccg
gtatagctattactctggctactatcatgggcactcatttgatgattgcgcgcgatacttgcgtccagatcgtgatgacg
ttgataaattgatcattggcagcttttgttctataggaagcggggcttccttcatcatggctggcaatcaggggcatcgg
catgactgggcatcatccttccccttcttttatatgcaagaggagcctgctttctcaagcgcactcgacgccttccaaag
agcaggtgataccgccattggcaatgatgtctggataggctcggaggcaatgattatgcccggcatcaaaattggagacg
gtgccgtaataggcagtcgctcgttggtgacaaaagatgtagagccttatgccatcatcggaggaaatcccgcaaagcaa
attaagaagcgcttctccgatgaggaaatatcattgctcatggagatggagtggtggagctggccactagataaaattaa
gacagcaatgccgctgctgtgctcgtcaaatatttttggtctgcataagtattggcgcgagtttgccgtctaa

>>MEG_1598|Drugs|Phenicol|Chloramphenicol_acetyltransferases|CATB|RequiresSNPConfirmation
atgaccaactactttgatagccccttcaaaggcaagctgctttctgagcaagtgaagaaccccaatatcaaagttgggcg
gtacagctattactctggctactatcatgggcactcattcgatgactgcgcacggtatctgtttccggaccgtgatgacg
ttgataagttgatcatcggtagtttctgctctatcgggagtggggcttcctttatcatggctggcaatcaggggcatcgg
tacgactgggcatcatctttcccgttcttttatatgcaggaagaacctgcattctcaagcgcactcgatgccttccaaaa
agcaggtaatactgtcattggcaatgacgtttggatcggctctgaggcaatggtcatgcccggagtcaagatcgggcacg
gtgcggtgataggcagccgctcgttggtgacaaaagatgtggagccttacgctatcgttggcggcaatcccgctaagaag
attaagaaacgcttcaccgatgaggaaatttcattgcttctggagatggagtggtggaattggtcactggagaagatcaa
agcggcaatgcccatgctgtgctcgtctaatattgttggcctgcacaagtattggctcgagtttgccgtctaa

>>MEG_1599|Drugs|Phenicol|Chloramphenicol_acetyltransferases|CATB|RequiresSNPConfirmation
atgaccaactactttgatagccccttcaaaggcaagctgctttctgagcaagtgaagaaccccaatatcaaagttgggcg
gtacagctattactctggctactatcatgggcactcattcgatgactgcgcacggtatctgtttccggaccgtgatgacg
ttgataagttgatcatcggtagtttctgctctatcgggagtggggcttcctttatcatggctggcaatcaggggcatcgg
tacgactgggcatcatctttcccgttcttttatatgcaggaagaacctgcattctcaagcgcactcgatgccttccaaaa
agcaggtaatactgtcattggcaatgacgtttggatcggctctgtggcgggggtcatgcccggaatcaagatcgggcacg
gtgcggtgataggcagccgctcgttggtgacaaaagatgtggagccttacgctatcgttggcggcaatcccgctaagaag
attaagaaacgcttcaccgatgaggaaatttcattgcttctggagatggagtggtggaattggtcactggagaagatcaa
agcggcaatgcccatgctgtgctcgtctaatattgttggcctgcacaagtattggctcgagtttgccgtctaa

>>MEG_1600|Drugs|Phenicol|Chloramphenicol_acetyltransferases|CATB|RequiresSNPConfirmation
atgaccaactactttgatagccccttcaaaggcaagctgctttctgagcaagtgaagaaccccaatatcaaagttgggcg
gtacagctattactctggctactatcatgggcactcattcgatgactgcgcacggtatctgtttccggaccgtgatgacg
ttgataagttgatcatcggtagtttctgctctatcgggagtggggcttcctttatcatggctggcaatcaggggcatcgg
tacgactgggcatcatctttcccgttcttttatatgcaggaagaacctgcattctcaagcgcactcgatgccttccaaaa
agcaggtaatactgtcattggcaatgacgtttggatcggctttgaggcaatggtcatgcccggaatcaagatcgggcacg
gtgcggtgataggcagccgctcgttggtgacaaaagatgtggagccttacgctatcgttggcggcaatcccgctaagaag
attaagaaacgcttcaccgatgaggaaatttcattgcttctggagatggagtggtggaattggtcactggagaagatcaa
agcggcaatgcccatgctgtgctcgtctaatattgttggcctgcacaagtattggctcgagtttgccgtctaa

>>MEG_1601|Drugs|Phenicol|Chloramphenicol_acetyltransferases|CATB|RequiresSNPConfirmation
atgaccaactactttgatagccccttcaaaggcaagctgctttctgagcaagtgaagaaccccaatatcaaagttgggcg
gtacagctattactctggctactatcatgggcactcattcgatgactgcgcacggtatctgtttccggaccgtgatgacg
ttgataagttgatcatcggtagtttctgctctatcgggagtggggcttcctttatcatggctggcaatcaggggcatcgg
tgcgactgggcatcatctttcccgttcttttatatgcaggaagaacctgcattctcaagcgcactcgatgccttccaaaa
agcaggtaatactgtcattggcaatgacgtttggatcggctctgaggcaatggtcatgcccggaatcaagatcgggcacg
gtgcggtgataggcagccgctcgttggtgacaaaagatgtggagccttacgctatcgttggcggcaatcccgctaagaag
attaagaaacgcttcaccgatgaggaaatttcattgcttctggagatggagtggtggaattggtcactggagaagatcaa
agcggcaatgcccatgctgtgctcgtctaatattgttggcctgcacaagtattggctcgagtttgccgtctaa

>>MEG_1602|Drugs|Phenicol|Chloramphenicol_acetyltransferases|CATB|RequiresSNPConfirmation
atgaccaactactttgatagccccttcaaaggcaagctgctttctgagcaagtgaagaaccccaatatcaaagttgggcg
gtacagctattactctggctactatcatgggcactcattcgatgactgcgcacggtatctgtttccggaccgtgatgacg
ttgataagttgatcatcggtagtttctgctctatcgggagtggggcttcctttatcgtggctggcaatcaggggcatcgg
tacgactgggcatcatctttcccgttcttttatatgcaggaagaacctgcattctcaagcgcactcgatgccttccaaaa
agcaggtaatactgtcattggcaatgacgtttggatcggctctgaggcaatggtcatgcccggaatcaagatcgggcacg
gtgcggtgataggcagccgctcgttggtgacaaaagatgtggagccttacgctatcgttggcggcaatcccgctaagaag
attaagaaacgcttcaccgatgaggaaatttcattgcttctggagatggagtggtggaattggtcactggagaagatcaa
agcggcaatgcccatgctgtgctcgtctaatattgttggcctgcacaagtattggctcgagtttgccgtctaa

>>MEG_1603|Drugs|Phenicol|Chloramphenicol_acetyltransferases|CATB|RequiresSNPConfirmation
atgaccaactactttgatagccccttcaaaggcaagctgctttctgagcaagtgaagaaccccaatatcaaagttgggcg
gtacagctattactctggctactatcatgggcactcattcgatgactgcgcacggtatctgtttccggactgtgatgacg
ttgataagttgatcatcggtagtttctgctctatcgggagtggggcttcctttatcatggctggcaatcaggggcatcgg
tacgactgggcatcatctttcccgttcttttatatgcaggaagaacctgcattctcaagcgcactcgatgccttccaaaa
agcaggtaatactgtcattggcaatgacgtttggatcggctctgaggcaatggtcatgcccggaatcaagatcgggcacg
gtgcggtgataggcagccgctcgttggtgacaaaagatgtggagccttacgctatcgttggcggcaatcccgctaagaag
attaagaaacgcttcaccgatgaggaaatttcattgcttctggagatggagtggtggaattggtcactggagaagatcaa
agcggcaatgcccatgctgtgctcgtctaatattgttggcctgcacaagtattggctcgagtttgccgtctaa

>>MEG_1604|Drugs|Phenicol|Chloramphenicol_acetyltransferases|CATB|RequiresSNPConfirmation
atgaaaaactactttaacagccctttcaaaggggaacttctttctgagcaagtgaaaaatccaaatatcagagtaggccg
gtatagctattactctggctactatcacgggcactcatttgatgaatgcgcgcgatacttgcttccagatcgtgaggacg
ttgataaattgatcattggcagcttttgttctataggaagcggggcttccttcatcatggctggcaatcaggggcatcag
catgactgggcatcatccttccccttcttctatatgcaagaggagcctgctttctcaagagcactcgacgccttccaaag
agcaggtgataccgtcattggcaatgatgtctggataggctcggaggcaatgattatgcctggcatcaaaattggagacg
gtgccgtgataggtagtcgctcgttggtgacaaaagatgtagagccttatgccatcatcgggggaaatcccgcaaagcaa
attaagaagcgcttctccgatgaggaaatctcattgctcatggagatggagtggtggaactggccactagataaaattaa
gacagcaatgcctctgctgtgctcgtcaaatatttttggtctgcataagtattggcgcgagtttgccgtctaa

>>MEG_1605|Drugs|Phenicol|Chloramphenicol_acetyltransferases|CATB|RequiresSNPConfirmation
atgaaaaactactttaacagccctttcaaaggggaacttctttctgagcaagtgaaaaatccaaatatcagagtaggccg
gtatagctattactctggctactatcacgggcactcatttgatgaatgcgcgcgatacttgtttccagatcgtgatgacg
ttgataaattgatcattggcagcttttgttctataggaagcggggcttccttcatcatggctggcaatcaggggcatcgg
catgactgggcatcatccttccccttcttctatatgcaagaggagcctgctttctcaagagcactcgacgccttccaaag
agcaggtgataccgtcattggcaatgatgtctggataggctcggaggcaatgattatgcctggcatcaaaattggagacg
gtgccgtgataggtagtcgctcgttggtgacaaaagatgtagagccttatgccatcatcgggggaaatcccgcaaagcaa
attaagaagcgcttctccgatgaggaaatctcattgctcatggagatggagtggtggaactggccactagataaaattaa
gacagcaatgcctctgctgtgctcgtcaaatatttttggtctgcataagtattggcgcgagtttgccgtctaa

>>MEG_1606|Drugs|Phenicol|Chloramphenicol_acetyltransferases|CATB|RequiresSNPConfirmation
atgaaaaactactttaacagccctttcaaaggggaacttctttctgagcaagtgaaaaatccaaatatcagagtaggccg
gtatagctattactctggctactatcacgggcactcatttgatgaatgcgcgcgatacttgtttccagatcgtgatgacg
ttgataaattgatcattggcagcttttgttctataggaagcggggcttccttcatcatggctggcaatcaggggcatcgg
catgactgggcatcatccttccccttcttctatatgcaagaggagcctgctttctcaagagcactcgacgccttccaaag
agcaggtgataccgtcattggcaatgatgtctggataggctcggaggcaatgattatgcctggcatcaaaattggagacg
gtgccgtgataggtagtcgctcgttggtgacaaaagatgtagagccttattccatcatcgggggaaatcccgcaaagcaa
attaagaagcgcttctccgatgaggaaatctcattgttcatggagatggagtggtggaactggccactagataaaattaa
gacagcaatgcctctgctgtgctcgtcaaatatttttggtctgcataagtattggcgcgagtttgccgtctaa

>>MEG_1607|Drugs|Phenicol|Chloramphenicol_acetyltransferases|CATB|RequiresSNPConfirmation
atgaaaaactactttaacagccctttcaaaggggaacttctttctgagcaagtgaaaaatccaaatatcagagtaggccg
gtatagctattactctggctactatcacgggcactcatttgatgaatgcgcgcgatacttgtttccagatcgtgatgacg
ttgataaattgatcattggcagcttttgttctataggaagcggggcttccttcatcatggctggcaatcaggggcatcgg
catgactgggcatcatccttccccttcttctatatgcaagaggagcctgctttctcaagagcactcgacgccttccaaag
agcaggtgataccgtcattggcaatgatgtctggataggctcggaggcaatgattatgcctggcatcaaaattggagacg
gtgccgtgataggtagtcgctcgttggtgacaaaagatgtggagccttacgctatcgttggcggcaatcccgctaagaag
attaagaaacgcttcaccgatgaggaaatttcattgcttctggagatggagtggtggaattggtcactggagaagatcaa
agcggcaatgcccatgctgtgctcgtctaatattgttggcctgcacaagtattggctcgagtttgccgtctcacaattca
atcaagccgatgccgcttcgcggcacggcttatttcaggcgttaggcatcacaaagtacagcatcgtgaccaacagcaac
gattccgtcacactgcgcctcatgactgagcatgaccttgcgatgctctatgagtggctaaatcgatctcatatcgtcga
gtggtggggcggagaagaagcacgcccgacacttgctgacgtacaggaacagtacttgccaagcgttttagcgcaagagt
ccgtcactccatacattgcaatgctgaatggagagccgattgggtatgcccagtcgtacgttgctcttggaagcggggac
ggatggtgggaagaagaaaccgatccaggagtacgcggaatagaccagtcactggcgaatgcatcacaactgggcaaagg
cttgggaaccaagctggttcgagctctggttgagttgctgttcaatgatcccgaggtcaccaagatccaaacggacccgt
cgccgagcaacttgcgagcgatccgatgctacgagaaagcggggtttgagaggcaaggtaccgtaaccaccccagatggt
ccagccgtgtacatggttcaaacacgccaggcattcgagcgaacacgcagtgatgcctaa

>>MEG_1608|Drugs|Phenicol|Chloramphenicol_acetyltransferases|CATB|RequiresSNPConfirmation
atgaaaaactactttaacagccctttcaaaggggaacttctttctgagcaagtgaaaaatccaaatatcagagtaggccg
gtatagctattactctggctactatcacgggcactcatttgatgaatgcgcgcgatacttgtttccagatcgtgatgacg
ttgataaattgatcattggcagcttttgttctataggaagcggggcttccttcatcatggctggcaatcaggggcatcgg
catgactgggcatcatccttccccttcttctatatgcaagaggagcctgctttctcaagtgcactcgacgccttccaaag
agcaggtgataccgtcattggcaatgatgtctggataggctcggaggcaatgattatgcctggcatcaaaattggagacg
gtgccgtgataggtagtcgctcgttggtgacaaaagatgtagagccttatgcactcatcgggggaaatcccgcaaagcaa
attaagaagcgcttctccgatgaggaaatctcattgctcatggagatggagtggtggaactggccactagataaaattaa
gacaacaatgcctctgctgtgctcgtcaaatatttttggtctgcataagtattggcgcgagtttgccgtctaa

>>MEG_1609|Drugs|Phenicol|Chloramphenicol_acetyltransferases|CATB|RequiresSNPConfirmation
atgaaaaactactttaacagccctttcaaaggggaacttctttctgagcaagtgaaaaatccaaatatcagagtaggccg
gtatagctattactctggctactatcacgggcactcatttgatgaatgcgcgcgatacttgtttccagatcgtgatgacg
ttgataaattgatcattggcagcttttgttctataggaagcggggcttccttcatcatggctggcaatcaggggcatcgg
tacgactgggcatcatctttcccgttcttttatatgcaggaagaacctgcattctcaagcgcactcgatgccttccaaaa
agcaggtaatactgtcattggcaatgacgtttggatcggctctgaggcaatggtcatgcccggaatcaagatcgggcacg
gtgcggtgataggcagccgctcgttggtgacaaaagatgtggagccttacgctatcgttggcggcaatcccgctaagaag
attaagaaacgcttcaccgatgaggaaatttcattgcttctggagatggagtggtggaattggtcactggagaagatcaa
agcggcaatgcccatgctgtgctcgtctaatattgttggcctgcacaagtattggctcgagtttgccgtctaa

>>MEG_1610|Drugs|Phenicol|Chloramphenicol_acetyltransferases|CATB|RequiresSNPConfirmation
atgaaaaactactttgacagccctttcaaaggggagcttctttctgagcaagtgaaaaatccaaacatcaaagtaggccg
ttatagctattactctggctactatcacggccactcatttgatgaatgcgcgcgatacttgcatccagatcgtgatgacg
ttgataaattgatcattggcagcttttgttctataggaagcggggcttccttcatcatggctggcaatcaggggcatcgg
catgactgggcatcatccttccccttcttctatatgcaagaggaacctgctttctcaagcgcactcgatgccttccaaag
agcaggtgataccgccattggcaatgatgtctggataggctcggaggcaatgattatgcccggaatcaaaattggagacg
gtgccgtgataggtagtcgctcgttggtgacaaaagatgtagtgccttatgccatcatcggaggaagtcccgcaaagcaa
attaagaagcgcttctccgatgaggaaatctcattgctcatggagatggagtggtggaactggccactggataaaattaa
gacagcaatgcctctgctgtgctcgtcaaatatttttggtctgcataagtattggcgcgagtttgtcgtctaa

>>MEG_1611|Drugs|Phenicol|Chloramphenicol_acetyltransferases|CATB|RequiresSNPConfirmation
atgaccaactactttgatagccccttcaaaggcaagctgctttctgagcaagtgaagaaccccaatatcaaagttgggcg
gtacagctattactctggctactatcatgggcactcattcgatgactgcgcacggtatctgcttccggaccgtgatgacg
ttgataagttgatcatcggtagtttctgctctatcgggagtggggcttcctttatcatggctggcaatcaggggcatcgg
tacgactgggcatcatctttcccgttcttttatatgcaagaagaacctgcattctcaaacgcactcgatgccttccaaaa
agcaggtaatactgtcattggcaatgacgtttggatcggctctgaggcaatggtcatgcccggaatcaagatcgggcacg
gtgcggtgataggcagccgctcgttggtgacaaaagatgtggagccttacgctatcgttggcggcaatcccgctaagaag
attaagaaacgcttcaccgatgaggaaatttcattgcttctggagatggagtggtggaattggtcactggagaagatcaa
agcggcaatgcccatgctgtgctcgtctaatattgttggcctgcacaagtactggctcgagtttgccgtctaa

>>MEG_1612|Drugs|Phenicol|Chloramphenicol_acetyltransferases|CATB|RequiresSNPConfirmation
atgaccaactactttgatagccccttcaaaggcaagctgctttctgagcaagtgaagaaccccaatatcaaagttgggcg
gtacagctattactctggctactatcatgggcactcattcgatgactgcgcacggtatctgtttccggaccgtgatgacg
ttgataagttgatcatcggtagtttctgctctatcgggagtggggcttcctttatcatggctggcaatcaggggcatcgg
tacgactgggcatcatctttcccgttcttttatatgcaggaagaacctgcattctcaagcgcactcgatgccttccaaaa
agcaggtaatactgtcattggcaatgacgtttggatcggctctgaggcaatggtcatgcccggaatcaagatcgggcacg
gtgcggtgataggcagccgctcgttggtgacaaaagatgtggagccttacgctatcgttggcggcaatcccgctaagaag
attaagaaacgcttcaccgatgaggaaatttcattgcttctggagatggaatggtggaattggtcactggagaagatcaa
agcggcaatgcccatgctgtgctcgtctaatattggtggcctgcacaagtattggctcgagtttgccgtctaa

>>MEG_1613|Drugs|Phenicol|Chloramphenicol_acetyltransferases|CATB|RequiresSNPConfirmation
atgaccaactactttgatagccccttcaaaggcaagctgctttctgagcaagtgaagaaccccaatatcaaagttgggcg
gtacagctattactctggctactatcatgggcactcattcgatgactgcgcacggtatctgtttccggaccgtgatgacg
ttgataagttgatcatcggtagtttctgctctatcgggagtggggcttcctttatcatggctggcaatcaggggcatcgg
tacgactgggcatcatctttcccgttcttttatatgcaggaagaacctgcattctcaagcgcactcgatgccttccaaaa
agcaggtaatactgtcattggcaatgacgtttggatcggctctgaggcaatggtcatgcccggaatcaagatcgggcacg
gtgcggtgataggcagccgctcgttggtgacaaaagatgtggagccttacgctatcgttggcggcaatcccgctaagaag
attaagaaacgcttcaccgatgaggaaatttcattgcttctggagatggagtggtggaattggtcactggagaagatcaa
agcggcaacgcccatgctgtgctcgtctaatattgttggcctgcacaagtattggctcgagtttgccgtctaa

>>MEG_1614|Drugs|Phenicol|Chloramphenicol_acetyltransferases|CATB|RequiresSNPConfirmation
atgaccaactactttgatagccccttcaaaggcaagctgctttctgagcaagtgaagaaccccaatatcaaagttgggcg
gtacagctattactctggctactatcatgggcactcattcgatgactgcgcacggtatctgtttccggaccgtgatgacg
ttgataagttgatcatcggtagtttctgctctatcgggagtggggcttcctttatcatggctggcaatcaggggcatcgg
tacgactgggcatcatctttcccgttcttttatatgcaggaagaacctgcattctcaagcgcactcgatgccttccaaaa
agcaggtaatactgtcattggcaatgacgtttggatcggctctgaggcaatggtcatgcccggaatcaagatcgggcacg
gtgcggtgataggcagccgctcgttggtgacaaaagatgtggagccttacgctatcgttggcggcaatcccgctaagaag
attaagaaacgcttcaccgatgaggaaatttcattgcttctggagatggagtggtggaattggtcactggagaagatcaa
agcggcaatgcccattctgtgctcgtctaatattgttggcctgcacaagtattggctcgagtttgccgtctaa

>>MEG_1615|Drugs|Phenicol|Chloramphenicol_acetyltransferases|CATB|RequiresSNPConfirmation
atgaccaactactttgatagccccttcaaaggcaagctgctttctgagcaagtgaagaaccccaatatcaaagttgggcg
gtacagctattactctggctactatcatgggcactcattcgatgactgcgcacggtatctgtttccggaccgtgatgacg
ttgataagttgatcatcggtagtttctgctctatcgggagtggggcttcctttatcatggctggcaatcaggggcatcgg
tacgactgggcatcatctttcccgttcttttatatgcaggaagaacctgcattctcaagcgcactcgatgccttccaaaa
agcaggtaatactgtcattggcaatgacgtttggatcggctctggggcaatggtcatgcccggaatcaagatcgggcacg
gtgcggtgataggcagccgctcgttggtgacaaaagatgtggagccttacgctatcgttggcggcaatcccgctaagaag
attaagaaacgcttcaccgatgaggaaatttcattgcttctggagatggagtggtggaattggtcactggagaagatcaa
agcggcagtgcccatgctgtgctcgtctaatattgttggcctgcacaagtattggctcgagtttgccgtctaa

>>MEG_1616|Drugs|Phenicol|Chloramphenicol_acetyltransferases|CATB|RequiresSNPConfirmation
atgaccaactactttgatagccccttcaaaggcaagctgctttctgagcaagtgaagaaccccaatatcaaagttggtcg
ggacagctattactctggctactatcatgggcactcattcgatgactgcgcacggtatctgtttccggaccgtgatgacg
ttgataagttgatcatcggtagtttctgctctatcgggagtggggcttcctttatcatggctggcaatcaggggcatcgg
tacgactgggcatcatctttcccgttcttttatatgcaggaagaacctgcattctcaagcgcactcgatgccttccaaaa
agcaggtaatactgtcattggcaatgacgtttggatcggctctgaggcaatggtcatgcccggaatcaagatcgggcacg
gtgcggtgataggcagccgctcgttggtgacaaaagatgtggagccttacgctatcgttggcggcaatcccgctaagaag
attaagaaacgcttcaccgatgaggaaatttcattgcttctggagatggagtggtggaattggtcactggagaagatcaa
agcggcaatgcccatgctgtgctcgtctaatattgttggcctgcacaagtattggctcgagtttgccgtctaa

>>MEG_1617|Drugs|Phenicol|Chloramphenicol_acetyltransferases|CATB|RequiresSNPConfirmation
atgaccaactattttgaaagtccatttaaaggcaaactgctggccgaccaggtaaagaacccgaacatcaaagtcggacg
gtatagctattattccggctattaccatggccattcgtttgacgagtgcgctcgctttctcttgccagatcgcaatgaca
tcgaccaactgatcgttggtagcttctgttccatcggcacgggcgcctccttcatcatggccggaaatcaggggcaccgt
tatgactgggcgtcttcttttcccttcttctacatgaaagaggagccagcattctcgggcgcacttgatgcattccaaaa
agccggtgacacagtcatcggaagtgatgtctggataggctctgaggccatgatcatgcccggcatcaacgtcggtcatg
gcgctgtgattggaagccgcgctttggtcacgaaagatgtggagccgtacactatcgttggcggaaatcccgccaaaccg
atcaagaaacgcttctccgacgaggagatcgccatgcttttgaaaatgaattggtgggattggccaactgaaaaaattga
ggaagcaatgcctttgctatgctcatccaacatcgttgggctgcatcgatactggcaaggctttgccgtctaa

>>MEG_1618|Drugs|Phenicol|Chloramphenicol_acetyltransferases|CATB|RequiresSNPConfirmation
atgacgaattattttgagagtcccttcaaagggaagcttctgactgagcaggtgaagaatccgaacatcaaggtagggcg
gtatagctactattccggctattaccatgggcactcgtttgatgattgtgctcgctaccttctaccagaccgtgatgacg
ttgatcagctgattatcggcagcttctgctccatcggatcaggcgcagcttttattatggctgggaatcaaggccaccga
tatgattgggtctcttctttccctttcttctacatgaacgaggagcccgcgtttgcaaaatcagtcgatgcattccagcg
ggctggcgacacagttataggaagtgatgtgtggatcggttcggaggccatgatcatgcccgggatcaagatcgggcatg
gagcggtgataggtagccgcgctttggttgccaaagacgtggaaccctacaccatagtggggggaaaccctgcaaagtcg
attaggaagcgcttttctgaagaagaaatttctatgcttttagatatggcttggtgggattggccgctggaacaaatcaa
ggaagcaatgccttttctttgttcgtctggcattgccagcctgtatcgtcgctggcaaggcacaagcgcctaa

>>MEG_1619|Drugs|Phenicol|Chloramphenicol_acetyltransferases|CATB|RequiresSNPConfirmation
ATGACCAACTACTTTGATAGCCCCTTCAAAGGCAAGCTGCTTTCTGAGCAAGTGAAGAACCCCAATATCAAAGTTGGGCG
GTACAGCTATTACTCTGGCTACTATCATGGGCACTCATTCGATGACTGCGCACGGTATCTGTTTCCGGACCGTGATGACG
TTGATAAGTTGATCATCGGTAGTTTCTGCTCTATCGGGAGTGGGGCTTCCTTTATCATGGCTGGCAATCAGGGGCATCGG
TACGACTGGGCATCATCTTTCCCGTTCTTTTATATGCAGGAAGAACCTGCATTCTCAAGCGCACTCGATGCCTTCCAAAA
AGCAGGTAATACTGTCATTGGCAATGACGTTTGGATCGGCTCTGAGGCAATGGTCATGCCCGGAATCAAGATCGGGCACG
GTGCGGTGATAGGCAGCCGCTCGTTGGTGACAAAAGATGTGGAGCCTTACGCTATCGTTGGCAGCAATCCCGCTAAGAAG
ATTAAGAAACGCTTCACCGATGAGGAAATTTCATTGCTTCTGGAGATGGAGTGGTGGAATTGGTCACTGGAGAAGATCAA
AGCGGCAATGCCCATGCTGTGCTCGTCTAATATTGTTGGCCTGCACAAGTATTGGCTCGAGTTTGCCGTCTAA

>>MEG_1620|Drugs|Phenicol|Chloramphenicol_acetyltransferases|CATB|RequiresSNPConfirmation
ATGACCAACTACTTTGATAGCCCCTTCAAAGGCAAGCTGCTTTCTGAGCAAGTGAAGAACCCCAATATCAAAGTTGGGCG
GTACAGCTATTACTCTGGCTACTATCATGGGCACTCATTCGATGACTGCGCACGGTATCTGTTTCCGGACCGTGATGACG
TTGATAAGTTGATCATCGGTAGTTTCTGCTCTATCGGGAGTGGGGCTTCCTTTATCATGGCTGGCAATCAGGGGCATCGG
TACGACTGGGCATCATCTTTCCCGTTCTTTTATATGCAGGAAGAACCTGCATTCTCAAGCGCACTCGATGCCTTCCAAAA
AGCAGGTAATACTGTCATTGGCAATGACGTTTGGATCGGCTCTGAGGCAATGGTCATGCCCGGAATCAAGATCGGGCACG
GTGCGGTGATAGGCAGCCGCTCGTTGGTGACAAAAGATGTGGGGCACTGTTGCAAAGTTAGCGATGAGGCAGCCTTTTGT
CTTATTCAAAGGCCTTACATTTCAAAAACTCTGCTTACCAGGCGCATTTCGCCCAGGGGATCACCATAA

>>MEG_1621|Drugs|Phenicol|Chloramphenicol_acetyltransferases|CATB|RequiresSNPConfirmation
ATGAACTTCTTTACGTCTCCATTTTCTGGGATTCCCTTAGATCAGCAAGTAACAAATCCGAACATTATTGTGGGAAAACA
CAGTTATTATTCTGGTTATTATCACGGGCACAGTTTCGATGATTGTGTGCGATATTTACATCCAGAAAGAGATGACGTTG
ATAAGTTAGTCATAGGGAGTTTTTGTTCTATAGGCTCTGGTGCTGTATTTATGATGGCCGGTAATCAAGGGCATCGCAGT
GATTGGATAAGTACATTCCCATTTTTCTATCAGGATAATGATAATTTTGCAGATGCACGCGATGGTTTTACGCGTTCAGG
AGACACAATTATTGGTCATGATGTGTGGATTGGCACTGAGGCTATGATAATGCCTGGGGTTAAAATTGGACATGGAGCGA
TAATCGCCAGTCGTTCAGTAGTGACTAAGGATGTTGCACCTTATGAAGTGGTCGGTTCAAATCCTGCTAAACATATCAAG
TTTAGATTTTCTGATGTGGAAATAGCGATGTTACTTGAAATGGCATGGTGGAATTGGCCAGAATCGTGGTTGAAAGAGAG
TATGCAGTCTCTGTGTTCATCAGACATTGAAGGGCTTTATCTCTATTGGCAGTCAAAAGCACGCACATAA

>>MEG_1622|Drugs|Phenicol|Chloramphenicol_acetyltransferases|CATB|RequiresSNPConfirmation
ATGAACTTCTTTACGTCTCCATTTTCTGGGATTCCCTTAGATCAGCAAGTAACAAATCCGAACATTATTGTGGGAAAACA
CAGTTATTATTCTGGTTATTATCACGGGCACAGTTTCGATGATTGTGTGCGATATTTACATCCAGAAAGAGATGACGTTG
ATAAGTTAGTCATAGGGAGTTTTTGTTCTATAGGCTCTGGTGCTGTATTTATGATGGCCGGTAATCAAGGGCATCGCAGT
GATTGGATAAGTACATTCCCATTTTTCTATCAGGATAATGATAATTTTGCAGATGCACGCGATGGTTTTACGCGTTCAGG
AGACACAATTATTGGTCATGATGTGTGGATTGGCACTGAGGCTATGATAATGCCTGGGGTTAAAATTGGACATGGAGCGA
TAATCGCCAGTCGTTCAGTAGTGACTAAGGATGTTGCACCTTATGAAGTGGTCGGTTCAAATCCTGCTAAACATATCAAG
TTTAGATTTTCTGATGTGGAAATAGCGATGTTACTTGAAATGGCATGGTGGAATTGGCCAGAATCGTGGTTGAAAGAGAG
TATGCAGTCTCTGTGTTCATCAGACATTGAAGGGCTTTATCTCAATTGGCAGTCAAAAGCACGCACATAA

>>MEG_1623|Drugs|Phenicol|Chloramphenicol_acetyltransferases|CATB|RequiresSNPConfirmation
ATGGAAAATTACTTTGACAGTCCCTTCAAAGGGAAACTACTTTCAGAGCAAGTGACTAACCGCAACATCAAAGTTGGTCG
GTACAGCTACTACTCTGGTTACTATCACGGGCATTCATTTGATGACTGCGCACGATACTTGCTCCCAGACCGTGATGACG
TTGACAAACTAATCATCGGCAGCTTTTGCTCCATCGGAAGCGGGGCTTCTTTCATCATGGCGGGCAATCAGGGTCACCGG
CATGACTGGGTAACATCTTTCCCTTTCTTCTACATGCAAGAAGAGCCAGCTTTTTCAAGTTCAACGGACGCCTTTCAAAA
GGCCGGTGACACCATCGTCGGCAATGATGTCTGGATAGGATCAGAGGCAATGATTATGCCCGGCATCAAGATTGGAGATG
GCGCGGTAATAGGCAGCCGATCGTTGGTGACGAGAGATGTAGAACCCTATACCATCATTGGCGGAAACCCTGCAAAGCAA
ATTAAAAAGCGATTCTCTGACGAGGAGATTTCATTACTCATGGAAATGGAGTGGTGGAACTGGCCGTTAGATAAAATCAA
AACAGCTATGCCCCTTCTCTGCTCTTCAGACATTTTTGGTCTGCACAGGCATTGGCGTGGGATTGCCGTCTAA

>>MEG_1624|Drugs|Phenicol|Chloramphenicol_acetyltransferases|CATB|RequiresSNPConfirmation
ATGAAAAACTACTTTAACAGCCCTTTCAAAGGGGAACTTCTTTCTGAGCAAGTGAAAAATCCAAATATCAGAGTAGGCCG
GTATAGCTATTACTCTGGCTACTATCACGGGCACTCATTTGATGAATGCGCGCGATACTTGCTTCCAGATCGTGATGACG
TTGATAAATTGATCATTGGCAGCTTTTGTTCTATAGGAAGCGGGGCTTCCTTCATCATGGCTGGCAATCAGGGGCATCGG
CATGACTGGGCATCATCCTTCCCCTTCTTCTATATGCAAGAGGAGCCTGCTTTCTCAAGAGCACTCGACGCCTTCCAAAG
AGCAGGTGATACCGTCATTGGCAATGATGTCTGGATAGGCTCGGAGGCAATGATTATGCCTGGCATCAAAATTGGAGACG
GTGCCGTGATAGGTAGTCGCTCGTTGGTGACAAAAGATGTAGAGCCTTATGCCATCATCGGGGGAAATCCCGCAAAGCAA
ATTAAGAAGCGCTTCTCCGATGAGGAAATCTCATTGCTCATGGAGATGGAGTGGTGGAACTGGCCACTAGATAAAATTAA
GACAGCAATGCCTCTGCTGTGCTCGTCAAATATTTTTGGTCTGCATAAGTATTGGCGCGAGTTTGCCGTCTAA

>>MEG_1625|Drugs|Phenicol|Chloramphenicol_acetyltransferases|CATB|RequiresSNPConfirmation
ATGAAGAACTATTTTGAGAGCCCGTTTAAGGGAAAACCTCTCGTCGAACAGGTAAAGAACCCAAATATCAAGGTGGGCCG
TTATAGCTATTATTCAGGCTATTACCACGGGCATTCATTTGATGATTGCGCTCGCTACCTCCTGCCTGATCGTGATGACG
TTGATAAATTGATAATTGGAAGCTTTTGCTCCATAGGGACGGGTGCATCTTTTATCATGGCTGGAAATCAAGGTCACCGA
TATGATTGGGTTACATCATTCCCTTTTTTCTATATGAATGAGGAACCGGCATTTTCGGAATCAGTTGATGCTTTCCAGGC
GGCAGGTAATACCGTCATAGGAAGCGACGTGTGGATTGGCTCTGAAGCAATGATTATGCCTGGAGTAAAGGTTGGCCATG
GAGCGGTAATTGGCAGCCGGGCTTTGGTTACCAAAGATATAGAGCCATACACAATTGTTGGTGGCAACCCTGCAAAAGAG
ATAAAGAAGCGCTTTTCAGAACAGGAAATTTCAATGTTGCTAGATATGAAGTGGTGGGATTGGCCGTTGGAGCAAATTAA
AGAAGCAATGCCTCTTTTGTGCTCGTCTGATATTGCAGGCTTGTACCATTTTTGGCAGCGTTCAAGTGCCTAA

>>MEG_1626|Drugs|Phenicol|Chloramphenicol_acetyltransferases|CATB|RequiresSNPConfirmation
ATGACGAATTATTTTGAGAGTCCCTTCAAAGGGAAGCTTCTGACTGAGCAGGTGAAGAATCCGAACATCAAGGTAGGGCG
GTATAGCTACTATTCCGGCTATTACCATGGGCACTCGTTTGATGATTGTGCTCGCTACCTTCTACCGGACCGTGATGACG
TTGATCAGCTGATTATCGGCAGCTTCTGCTCCATCGGATCAGGCGCAGCTTTTATTATGGCTGGGAATCAAGGCCACCGA
TATGATTGGGTCTCTTCTTTCCCTTTCTTCTACATGAACGAGGAGCCCGCGTTTGCAAAATCAGTCGATGCATTCCAGCG
GGCTGGCGACACAGTTATAGGAAGTGATGTGTGGATCGGTTCGGAGGCCATGATCATGCCCGGGATCAAGATCGGGCATG
GAGCGGTGATAGGTAGCCGCGCTTTGGTTGCCAAAGACGTGGAACCCTACACCATAGTGGGGGGAAACCCTGCAAAGTCG
ATTAGGAAGCGCTTTTCTGAAGAAGAAATTTCTATGCTTTTAGATATGGCTTGGTGGGATTGGCCGCTGGAACAAATCAA
GGAAGCAATGCCTTTTCTTTGTTCGTCTGGCATTGCCAGCCTGTATCGTCGCTGGCAAGGCACAAGCGCCTAA

>>MEG_1627|Drugs|Phenicol|Chloramphenicol_acetyltransferases|CATB|RequiresSNPConfirmation
ATGACGAATTATTTTGAGAGTCCCTTCAAAGGGAAGCTTCTGACTGAGCAGGTGAAGAATCCGAACATCAAGGTAGGGCG
GTATAGCTACTATTCCGGCTATTACCATGGGCACTCGTTTGATGATTGTGCTCGCTACCTTCTACCAGACCGTGATGACG
TTGATCAGCTGATTATCGGCAGCTTCTGCTCCATCGGATCAGGCGCAGCTTTTATTATGGCTGGGAATCAAGGCCACCGA
TATGATTGGGTCTCTTCTTTCCCTTTCTTCTACATGAACGAGGAGCCCGCGTTTGCAAAATCAGTCGATGCATTCCAGCG
GGCTGGCGACACAGTTATAGGAAGTGATGTGTGGATCGGTTCGGAGGCCATGATCATGCCCGGGATCAAGATCGGGCATG
GAGCGGTGATAGGTAGCCGCGCTTTGGTTACCAAAGACGTGGAACCCTACACCATAGTGGGGGGAAACCCTGCAAAGTCG
ATTAGGAAGCGCTTTTCTGAAGAAGAAATTTCTATGCTTTTAGATATGGCTTGGTGGGATTGGCCGCTGGAACAAATCAA
GGAAGCAATGCCTTTTCTTTGTTCGTCTGGCATTGCCAGCCTGTATCGTCGCTGGCAAGGCACAAGCGCCTAA

>>MEG_1628|Drugs|Phenicol|Chloramphenicol_acetyltransferases|CATB|RequiresSNPConfirmation
ATGAAAAATTTCTTCGAAAGTCCTTTTAAAGGAAAAATAATCAAAGACCACATAACTAATCCCAATATAATTTCGGGTAA
ATATTCTTATTATTCCGGTTATTATCACGGTCATTCATTTGATGATTGTGCTCGTTATCTGTTTCCGGACAGGAATGATG
TCGATAAACTAATTATCGGTTCTTACTGCTCAATAGGGAGTGGTGCAAGTTTCATAATGGCAGGTAATCAAGGTCATAAA
TATGATTGGATTTCCAGTTTTCCATTTTTTTATATGTCTGAATTTGATGTTTTCAGTAAAAGCCAAGATGGATTTCAAAA
AGCAGGAGATACAGTTGTTGGGAATGATGTTTGGATTGGTAGTGAAGCTATGATAATGCCAGGAGTTCAGATAGGAGATG
GAGCTGTTATTGGCAGTCGTGCTTTGGTTACAAAAGATGTTGAACCTTATTCAATTGTAGGGGGAAATCCAGCCAAATTG
ATAAAAAAGAGATTTAGTGATGATGACATCCAAAAATTGCAGGAAATGAAATGGTGGGAATGGGATGAAGAAACCCTTTT
TGAAGCAATGCCAATTCTTTGTTCAAATAAAATCGATTTGTTGTACAAGTTTTTTAGAAAAATGAAATGA

>>MEG_1629|Drugs|Phenicol|Chloramphenicol_acetyltransferases|CATB|RequiresSNPConfirmation
ATGACCAATTTCTTCGAAAGCCCGTTCAAGGGCATCCCGCTCGATCAGCAGGTGACGCATCCCAACATCGTCGTCGGGCG
GCACAGCTATTATTCGGGCTATTATCACGGGCACGGTTTTGACGACTGCGCGCGGTATGTGTTGCCCGATGCCGATGCCG
ACCGGCTGATCATCGGCGCGTTCTGTTCGATCGGCTCGGGCGCGGCGTTCATCATGGCGGGCAATCAGGGGCACCGCCAT
GAATGGGTGAGCACATTCCCCTTCTTCTATGCGAACGAGAGCTGGCAGCAGGCGCAGGCGGCGGACGGCTATCTGCCCGC
CGGAGACACGGTGATCGGCAATGATGTGTGGATCGGCAGCGAGGCGATCATCATGCCCGGCGTGCGCGTGGGCGACGGCG
CGATCATCGGCACGCGTGCGCTGGTGACGCGCGATGTCGAGCCCTATGCGATTGTCGGCGGCAACCCGGCACGGGTGCTG
CGCAAGCGGTTCGACGAAGACCGGATCGCGCTGCTGCTCGAGATGCGGTGGTGGGACTGGCCCGATGCCGCGATCGAGGC
GACGATGCCGCTGATGACGAGCGGCGATATCGAGGGGCTGCACGCCGCCTGGCAGCGCCAGACGCGGCGGTGA

>>MEG_1630|Drugs|Phenicol|Chloramphenicol_acetyltransferases|CATB|RequiresSNPConfirmation
ATGACCAACTACTTTGATAGCCCCTTCAAAGGCAAGCTGCTTTCTGAGCAAGTGAAGAACCCCAATATCAAAGTTGGGCG
GTACAGCTATTACTCTGGCTACTATCATGGGCACTCATTCGATGACTGCGCACGGTATCTGTTTCCGGACCGTGATGACG
TTGATAAGTTGATCATCGGTAGTTTCTGCTCTATCGGGAGTGGGGCTTCCTTTATCATGGCTGGCAATCAGGGGCATCGG
TACGACTGGGCATCATCTTTCCCGTTCTTTTATATGCAGGAAGAACCTGCATTCTCAAGCGCACTCGATGCCTTCCAAAA
AGCAGGTAATACTGTCATTGGCAATGACGTTTGGATCGGCTCTGAGGCAATGGTCATGCCCGGAATCAAGATCGGGCACG
GTGCGGTGATAGGCAGCCGCTCGTTGGTGACAAAAGATGTGGAGCCTTACGCTATCGTTGGCGGCAATCCCGCTAAGAAG
ATTAAGAAACGCTTCACCGATGAGGAAATTTCATTGCTTCTGGAGATGGAGTGGTGGAATTGGTCACTGGAGAAGATCAA
AGCGGCAATGCCCATGCTGTGCTCGTCTAATATTGTTGGCCTGCACAAGTATTGGCTCGAGTTTGCCGTCTAA