MEGAResFrom MEG, the Microbial Ecology Group

Notice: Trying to access array offset on value of type null in /home/meglabuser/megares.meglab.org/vendor/doctrine/annotations/lib/Doctrine/Common/Annotations/DocParser.php on line 967

CATA

The cat genes encode chloramphenicol acetyltransferases. Upregulation of the transcription of this gene is induced by the presence of chloramphenicol, and the gene is usually found on a plasmid.

References

  • http://www.ncbi.nlm.nih.gov/pubmed/6340955

Notice: Trying to access array offset on value of type null in /home/meglabuser/megares.meglab.org/vendor/doctrine/annotations/lib/Doctrine/Common/Annotations/DocParser.php on line 967

Other Groups in Chloramphenicol acetyltransferases

Sequences

Download Sequences

>>MEG_1560|Drugs|Phenicol|Chloramphenicol_acetyltransferases|CATA
atgaaatttaacactattaatcgtgatacatgggatcgaaaagaatattttgaacactatttacagcagcagacaacatt
cagtctgacgaatgaaattaatataactatacttatgaagaacttaaagaaaaagcattataagttatatcctgcgttta
tttttatggtgacaaaaatcgtgaacgcccatagagaatttagaataaattttaactcagaaggaaatttaggttactgg
acggagatttgcccactctataccatttttgataacaaatcacacacattttctggcatctggtcaccaaacttaactat
tttttctgagtttcattctaaatatgaaaatgatgcagaaagatacaatggcacgaggagattatttccaaaaaaaccaa
taccagataacactattccgatttctatgattccttggagttcttttacagcatttaatctaaatataaataatggcgga
gattttctcttacccataataactggagggaagtattcacaagtaaatgatgaattattcctgcctgtctctatccaaat
gcatcatgctatttgtgatggctaccatgcaagtgtttttatcaatgacttacaaaaacttgctgatgaaagtgaagact
ggatttaa

>>MEG_1561|Drugs|Phenicol|Chloramphenicol_acetyltransferases|CATA
atgaaatttaatttgatagatatagaggattggaatagaaagccatactttgagcattatttaaatgcggtaaggtgcac
ttacagtatgactgcaaatttagagataactagtttactgcgtgaaattaaacttaagggcctgaaactgtaccctacgc
ttatttatatcatcacaactgtagttaatcgtcacaaggagttccgcaccagttttgatcaaaacggtaagttaggatac
tgggatagtatgaacccaagttatactatctttcataaggataacgaaactttttcaagtatttggacagagtatgacga
gaacttcccacgtttctactataattaccttgaggatatcagaaactatagcgacgttatgaatttcatgcctaaggcag
gtcaacctgctaacacaattaatgtgtccagcattccttgggtgaattttaccggattcaacttgaatatatataatgat
gcaacatatctaatccctatttttacattgggtaagtattttcagcaggataataaaattttattacctatgtctgtaca
ggtgcatcatgcggtttgcgacggttaccataccagcagattttttaatgaggcacaggaattagcctcaaattttgaga
catggttaggagaaaaataa

>>MEG_1562|Drugs|Phenicol|Chloramphenicol_acetyltransferases|CATA
atgaactatacaaaatttgatgtaaaaaattgggttcgccgtgagcattttgagttttatcggcatcgtttaccatgtgg
ttttagcttaacaagcaaaattgatatcacgacgttaaaaaagtcattggatgattcagcgtataagttttatccggtaa
tgatctatctgattgctcaggccgtgaatcaatttgatgagttgagaatggcgataaaagatgatgaattgatcgtatgg
gattcagtcgacccacaattcaccgtattccatcaagaaacagagacattttcagcactgagttgcccatactcatccga
tattgatcaatttatggtgaattatttatcggtaatggaacgttataaaagtgataccaagttatttcctcaaggggtaa
caccagaaaatcatttaaatatttcagcattaccttgggttaattttgatagctttaatttaaatgttgctaattttacc
gattattttgcacccattataacaatggcaaaatatcagcaagaaggggatagactgttattgccgctctcagtacaggt
tcatcatgcagtttgtgatggcttccatgttgcacgctttattagtcggctacaagagttgtgtaacagtaaattaaaat
aa

>>MEG_1563|Drugs|Phenicol|Chloramphenicol_acetyltransferases|CATA
atgaactttaataaaattgatttagacaattggaagagaaaagagatatttaatcattatttgaaccaacaaacgacttt
tagtataaccacagaaattgatattagtgttttataccgaaacataaaacaagaaggatataaattttaccctgcattta
ttttcttagtgacaagggtgataaactcaaatacagcttttagaactggttacaatagcgacggagagttaggttattgg
gataagttagagccactttatacaatttttgatggtgtatctaaaacattctctggtatttggactcctgtaaagaatga
cttcaaagagttttatgatttatacctttctgatgtagagaaatataatggttcggggaaattgtttcccaaaacaccta
tacctgaaaatgctttttctctttctattattccatggacttcatttactgggtttaacttaaatatcaataataatagt
aattaccttctacccattattacagcaggaaaattcattaataaaggtaattcaatatatttaccgctatctttacaggt
acatcattctgtttgtgatggttatcatgcaggattgtttatgaactctattcaggaattgtcagataggcctaatgact
ggcttttataa

>>MEG_1564|Drugs|Phenicol|Chloramphenicol_acetyltransferases|CATA
atgaactttaataaaattgatttagacaattggaagagaaaagagatatttaatcattatttgaaccaacaaacgacttt
tagtataaccacagaaattgatattagtgttttataccgaaacataaaacaagaaggatataaattttaccgtgcattta
ttttcttagtgacaagggtgataaactcaaatacagcttttagaactggttacaatagcgacggagagttaggttattgg
gataagttagagccactttatacaatttttgatggtgtatctaaaacattctctggtatttggactcctgtaaagaatga
cttcaaagagttttatgatttatacctttctgatgtagagaaatataatggttcggggaaattgtttcccaaaacaccta
tacctgaaaatgctttttctctttctattattccatggacttcatttactgggtttaacttaaatatcaataataatagt
aattaccttctacccattattacagcaggaaaattcattaataaaggtaattcaatatatttaccgctatctttacaggt
acatcattctgtttgtgatggttatcatgcaggattgtttatgaactctattcaggaattgtcagataggcctaatgact
ggcttttataa

>>MEG_1565|Drugs|Phenicol|Chloramphenicol_acetyltransferases|CATA
atgaactttaataaaattgatttatacaattggaagagaaaagagatatttaatcattatttgaaccaacaaacgacttt
tagtataaccacagaaattgatattagtgttttataccgaaacataaaacaagaaggatataaattttaccctgcattta
tttccttagtgacaagggtgataaactcaaatacagcttttagaactggttaccataacgacggagaattaggttattgg
gataagttagagccactttatacaatttttgatggtgattctagaacatcctctggtattgggactcctgtaaagaatga
ctccaaagagttttatgaattatacctttctgatgttgaaaaatataatggttcggggaaattgtttcccaaaacaccta
tacctgaaaatgctttttctctttctattattccatggactctatttactgggtttaacttaaatatccataataatagt
aattaccttctacccattataacggcaggaaaattcattaatataggtaattcaatatatttaccgctatctttacagga
acatcattctgttggtgatggttatcatgcaggactgtttatgaactctattcaggaattgtcagataggcctaatgact
ggcttttataa

>>MEG_1566|Drugs|Phenicol|Chloramphenicol_acetyltransferases|CATA
atgaattttaccagaattgatctgaacacctggaaccgcagagaacattttgctctttatcgtcagcagataaaatgcgg
attcagcctgaccacaaaactcgatattacagctttgcgtaccgcactggcggaaacggattataaattttatccggtga
tgatttatctgatctcccgggttgttaatcagtttccggagttccggatggcaatgaaagataatgcactgatttactgg
gatcagaccgatcctgtatttactgtttttcataaagagactgaaacattttctgcgctcttctgccgttattgtccgga
tatcagtgaatttatggcgggctataatgcggtgatggcagaatatcagcataatactgcattgttcccgcagggagcgt
taccagagaaccacctgaatatatcatcattaccctgggtgagttttgacggatttaacctgaatatcaccggtaatgat
gattattttgctccggtgtttactatggcgaagtttcagcaggaagataaccgcgtattattacctgtttctgtacaggt
acatcatgccgtttgtgatggctttcatgcagccaggtttattaatacacttcagatgatgtgtgataacatactgaaat
aa

>>MEG_1567|Drugs|Phenicol|Chloramphenicol_acetyltransferases|CATA
atgaattttacccggattgacctgaatacctggaatcgcagggaacactttgccttctatcgtcagcagattaaatgcgg
attcagcctgaccaccaaactcgatattaccgctttgcgtaccgcactggcggagacaggttataagttttatccgctga
tgatttacctgatctcccgggctgttaatcagtttccggagttccggatggcactgaaagacaatgaacttatttactgg
gaccagtcagacccggtctttactgtctttcataaagaaaccgaaacattctctgcactgtcctgccgttattttccgga
tctcagtgagtttatggcaggttataatgcggtaacggcagaatatcagcatgataccagattgtttccgcagggaaatt
taccggagaatcacctgaatatatcatcattaccgtgggtgagttttgacggatttaacctgaacatcaccggaaatgat
gattattttgccccggtttttacgatggcaaagtttcagcaggaaggtgaccgcgtattattacctgtttctgtacaggt
tcatcatgcagtctgtgatggctttcatgcagcacggtttattaatacacttcagctgatgtgtgataacatactgaaat
aa

>>MEG_1568|Drugs|Phenicol|Chloramphenicol_acetyltransferases|CATA
atgaattttacccggattgacctgaatacctggaatcgcagggaacattttgccctttatcgtcagcagattaaatgcgg
attcagcctgaccaccaaactcgatattaccgctttgcgtactgcactggcgaaaaccggttataagttttatccgctga
tgatttacctgatctcccgggctgttaatcagtttccggagttccggatggcaatgaaagataatgaactgatttactgg
gaacagtcagacccggtctttactgtctttcataaagaaaccgaaacattctccgcactgtcctgccgttattttccgga
tctcagtgagtttatggcgggttataacgcggtaacagcagaatatcagcatgataccaggttgtttccgcagggaaatt
taccggagaatcacctgaatatatcatcgttaccctgggtgagttttgacggatttaatctgaatatcaccggaaatgat
gattatttttccccggtttttacaatggcaaagtttcagcaggaaggtgaccgcgtactattacctgtttctgtacaggt
tcatcatgcagtctgtgatggttttcatgcagcaaggtttatcaatacacttcagctgatgtgtgataacatactgaaat
aa

>>MEG_1569|Drugs|Phenicol|Chloramphenicol_acetyltransferases|CATA
atgacttttaatattatcaaattagaaaattgggatagaaaagaatattttgaacactattttaaccagcaaactacgta
tagcattactaaagaaattgatattactttgtttaaagatatgagtaaaaagaaaggatatgaaatttatccttctttga
tttatgcaattatggaagttgtaaataaaaataaagtgtttagaacaggaattaatagtgagaataaattaggttattgg
gataagttaaatcctttgtatacagtttttaataagcaaactgaaaaatttactaacatttggactgaatctgataacaa
cttcacttctttttataataattataaaaatgacttgcttgaatataaagataaagaagaaatgtttcctaaaaaaccga
tacctgaaaacaccctaccgatttcaatgattccttggattgattttagttcatttaatttaaacattggtaacaatagc
aactttttattgcctattattacgataggtaaattttatagtgagaataataaaatttatataccagttgccttgcagct
tcatcatgctgtatgtgatggttaccatgcttcattatttataaatgaatttcaagatataattaagaaggtagatgatt
ggatttag

>>MEG_1570|Drugs|Phenicol|Chloramphenicol_acetyltransferases|CATA
atgacttttaatattatcaaattagaaaattgggatagaaaagaatattttgaacactattttaaccagcaaactacgta
tagcattactaaagaaattgatattactttgtttaaagatatgataaaaaagaaaggatatgaaatttatccttctttga
tttatgcaattatggaagttgtaaataaaaataaagtgtttagaacaggaattaatagtgagaataaattaggctattgg
gataagttaaatcctttgtatacagtttttaataagcaaactgaaaaatttactaacatttggactgaatctgataacaa
cttcacttctttttataataattataaaaatgacttgtttgaatataaagataaagaagaaatgtttcctaaaaaaccga
tacctgaaaacaccataccgatttcaatgattccttggattgattttagttcatttaatttaaacattggtaacaatagc
agctttttattgcctattattacgataggtaaattttatagtgagaataataaaatttatataccagttgccttacagct
tcatcatgctgtatgtgatggttaccatgcttcattatttataaatgaatttcaagatataattaataaggtagatgatt
ggatttag

>>MEG_1571|Drugs|Phenicol|Chloramphenicol_acetyltransferases|CATA
atgacttttaatattatcaaattagaaaattgggatagaaaagaatattttgaacactattttaaccagcaaactacgta
tagcattactaaagaaattgatattactttgtttaaagatatgataaaaaagaaaggatatgaaatttatccttctttga
tttatgcaattatggaagttgtaaataaaaataaagtgtttagaacaggaattaatagtgagaataaattaggctattgg
gataagttaaatcctttgtatacagtttttaataagcaaactgaaaaatttactaacatttggactgaatctgataacaa
cttcacttctttttataataattataaaaatgacttgtttgaatataaagataaagaagaaatgtttcctaaaaaagcga
tacctgaaaacaccataccgatttcaatgattccttggattgattttagttcatttaatttaaacattggtaacaatagc
agctttttattgcctattattacgataggtaaattttatagtgagaataataaaatttatataccagttgccttacagct
tcatcatgctgtatgtgatggttaccatgcttcattatttataaatgaatttcaagatataattaataaggtagatgatt
ggatttag

>>MEG_1572|Drugs|Phenicol|Chloramphenicol_acetyltransferases|CATA
atgacttttaatattatcaaattagaaaattgggatagaaaagaatattttgaacactattttaaccagcaaactacgta
tagcattactaaagaaattgatattactttgtttaaagatatgataaaaaagaaaggatatgaaatttatccttctttga
tttatgcaattatggaagttgtaaataaaaataaagtgtttagaacaggaattaatagtgagaataaattaggttattgg
gataagttaaatcctttgtatacagtttttaataagcaaactgaaaaatttactaacatttggactgaatctgataacaa
cttcacttctttttataataattataaaaatgacttgcttgaatataaagataaagaagaaatgtttcctaaaaaaccga
tacctgaaaacaccataccgatttcaatgattccttggattgattttagttcatttaatttaaacattggtaacaatagc
aactttttattgcctattattacgataggtaaattttatagtgagaataataaaatttatataccagttgctttgcagct
tcatcatgctgtatgtgatggttaccatgcttcattatttatgaatgaatttcaagatataattcataaggtagatgatt
ggatttag

>>MEG_1573|Drugs|Phenicol|Chloramphenicol_acetyltransferases|CATA
atgacttttaatattattaatttagaaacttgggatagaaaagaatatttcaatcattattttaatcaacaaacaactta
tagtgttactaaagaattagatattaccttgttaaaaagtatgataaagaataaaggatatgaactgtatcctgctttga
ttcatgcaattgtaagtgttataaatcgaaataaagtatttagaacagggattaatagtgaggggaatttgggttattgg
gataaattagaacctttatatacagtctttaataaagaaactgaaaatttttctaatatttggacagaatcaaatgctag
ttttactcttttttataatagttataagaatgatttaattaaatataaagataaaaatgaaatgtttcctaaaaagccga
tacctgaaaacacagttcctatctcgatgattccttggattgattttagttcatttaatttaaatattggtaataatagt
agatttttattgccaattattacaataggtaaattttatagtaaggatgataagatctatttaccatttccattgcaagt
ccatcatgcagtatgtgatggttaccatgtttcattatttatgaatgaatttcaaaatataattcgataa

>>MEG_1574|Drugs|Phenicol|Chloramphenicol_acetyltransferases|CATA
atgacttttaatattattaatttggaaacttgggatagaaaagaatattttaatcattatttcaatcaacaaacaactta
cagtgttactaaagaatttgatatcactttacttaaaagtatgataaaaaataaaggatatgaactgtatcctgctttga
tttatacaattgtaaatattataaatcaaaataaagtatttagaacaggaattaatagtagtggaaatttgggattttgg
gataaattaaaccctttatatacatgtttaataaacgaaactgaaaaatttctaaacatttggatagaatcaaatgttag
ttttagttctttttataatagttataagagtgacttacttgaatataaagatacaaatgaaatgtttcctaaaaaaccaa
tacctgaaaacacaggtcctatttcgatgattccttggattgattttagttcatttaatttaaatattggtaataatagt
agattcctattgccaattattacaataggtaaattttatagtaagaataataagatctatttaccagtctcattgcaagt
tcatcatgcggtatgtgatggttaccatgtttcattatttatgagtgaatttcaaaatatagttgatagtgtaaatgaat
gggatttaaatctaaaataa

>>MEG_1575|Drugs|Phenicol|Chloramphenicol_acetyltransferases|CATA
atgacttttaatattattaatttggaaacttgggatagaaaagaatattttaatcattatttcaatcaacaaacaactta
cagtgttactaaagaatttgatatcactttacttaaaagtatgataaaaaataaaggatatgaactgtatcctgctttga
tttatacaattgtaaatattataaatcaaaataaagtatttagaacaggaattaatagtgagggaaatttgggttattgg
gataaattaaaccctttatatacagtctttaataaagaaactgaaaaattttctaacatttggacagaatcaaatgttag
ttttaattctttttataatagttataagagtgacttacttgaatataaagataaaaatgaaatgtttcctaaaaaaccaa
tacctgaaaacacagttcctatttcgatgattccttggattgattttagttcatttaatttaaatattggtaataatagt
agattcctattgccaattattacaataggtaaattttatagtaagaataataagatctatttaccagtctcattgcaagt
tcatcatgcggtatgtgatggttaccatgtttcattatttatgagtgaatttcaaaatatagttgatagtgtaaatgaat
ggatttaa

>>MEG_1576|Drugs|Phenicol|Chloramphenicol_acetyltransferases|CATA
atgcaattcacaaagattgatataaataattggacacgaaaagagtatttcgaccactattttgacaatacgccctgcac
atatagtatgacggtaaaactcgatatttctaagttgaaaaaggatggaaaaaaattatatccgactctcttatatgggg
ttacaacaatcctcaatcgacacgaagagttcaggacggcattagataaaaacggacaggtaggtgttttttcagaaatg
ctgccttgctacacaatctttcataaggaaactgaaaccttttcgagtatttggactgagtttacagcagactatactga
gtttcttcagaactatcaaaaggatatagacgcttatggtgaacgaaagggaatgttcgcaaagcctaatcctccggaaa
acactttccctgtttctatgataccgtggacaagctttgaaggctttaacttaaatctaaaaaaaggatatgactatcta
ctgccgatatttacgtttgggaagtattatgaggatggcggaaaatactatattcccttatcgattcaagtgcatcatgc
cgtttgtgatggctttcatgtttgccgttttttggatgaattacaagacttgctgaataaataa

>>MEG_1577|Drugs|Phenicol|Chloramphenicol_acetyltransferases|CATA
atggacgccccgatcccgaccccggccccgatcgacctcgacacgtggccgcgccggcagcacttcgaccactaccgccg
gcgcgtcccgtgcacgtacgcgatgacggtggaggtggacgtcaccatcttcgccgcggccctgcgccgctcaccgcgca
agtcgtacctcgcccaggtctgggcgctcgccacggtcgtcaaccggcacgaagagttcaggatgtgcctcaccgattcg
ggcgacccggccgtctggccggtcgtgcaccccgccttcacggtcttcaacccggagcgcgagaccttcgcctgcgtgtg
ggccccctacgaccccgacttcggcaccttccacgacacggcggcccccctcctcgccgagcacagccgcgccaccgact
tcttcccgcagggggacccgccccccaacaccttcgacgtgtcgagccttccgtgggcctccttcaccggcttcaccctc
aacatccgcgacggctgggaccacctcgcccccatcttcaccctcggccgctacaccgaacgcgaaggccgcctcctgct
ccccctctccgtacagatccaccacgccgccgccgacggcttccacacagcccgcctcaccaacgacctccaaaccctgc
tcgccgccccgacctggctgtga

>>MEG_1578|Drugs|Phenicol|Chloramphenicol_acetyltransferases|CATA
atggagaaaaaaatcactggatataccaccgttgatatatcccaatggcatcgtaaagaacattttgaggcatttcagtc
agttgctcaatgtacctataaccagaccgttcagctggatattacggcctttttaaagaccgtaaagaaaaataagcaca
agttttatccggcctttattcacattcttgcccgcctgatgaatgctcatccggaattacgtatggcaatgaaagacggt
gagctggtgatatgggatagtgttcacccttgttacaccgttttccatgagcaaactgaaacgttttcatcgctctggag
tgaataccacgacgatttccggcagtttctacacatatattcgcaagatgtggcgtgttacggtgaaaacctggcctatt
tccctaaagggtttattgagaatatgtttttcgtctcagccaatccctgggtgagtttcaccagttttgatttaaacgtg
gccaatatggacaacttcttcgcccccgttttcaccatgggcaaatattatacgcaaggcgacaaggtgctgatgccgct
ggcgattcaggttcatcatgccgtttgtgatggcttccatgtcggcagaatgcttaatgaattacaacagtactgcgatg
agtggcagggcggggcgtaa

>>MEG_1579|Drugs|Phenicol|Chloramphenicol_acetyltransferases|CATA
ATGACTTTTAATATTATTAATTTGGAAACTTGGGATAGAAAAGAATATTTTAATCATTATTTCAATCAACAAACAACTTA
CAGTGTTACTAAAGAATTTGATATCACTTTACTTAAAAGTATGATAAAAAATAAAGGATATGAACTGTATCCTGCTTTGA
TTTATACAATTGTAAATATTATAAATCAAAATAAAGTATTTAGAACAGGAATTAATAGTGAGGGAAATTTGGGTTATTGG
GAAAAATTAAACCCTTTATATACAGTCTTTAATAAAGAAACTGAAAAATTTTCTAACATTTGGACAGAATCAAATGTTAG
TTTTAATTCTTTTTATAATAGTTATAAGAGTGACTTACTTGAATATAAAGATAAAAATGAAATGTTTCCTAAAAAACCAA
TACCTGAAAACACAGTTCCTATTTCGATGATTCCTTGGATTGATTTTAGTTCATTTAATTTAAATATTGGTAATAATAGT
AGATTCCTATTGCCAATTATTACAATAGGTAAATTTTATAGTAAGAATAATAAGATCTATTTACCAGTCTCATTGCAAGT
TCATCATGCGGTATGTGATGGTTACCATGTTTCATTATTTATGAGTGAATTTCAAAATATAGTTGATAGTGTAAATGAAT
GGATTTAA

>>MEG_1580|Drugs|Phenicol|Chloramphenicol_acetyltransferases|CATA
ATGGAGAAAAAAATCACTGGATATACCACCGTTGATATATCCCAATGGCATCGTAAAGAACATTTTGAGGCATTTCAGTC
AGTTGCTCAATGTACCTATAACCAGACCGTTCAGCTGGATATTACGGCCTTTTTAAAGACCGTAAAGAAAAATAAGCACA
AGTTTTATCCGGCCTTTATTCACATTCTTGCCCGCCTGATGAATGCTCATCCGGAATTCCGTATGGCAATGAAAGACGGT
GAGCTGGTGATATGGGATAGTGTTCACCCTTGTTACACCGTTTTCCATGAGCAAACTGAAACGTTTTCATCGCTCTGGAG
TGAATACCACGACGATTTCCGGCAGTTTCTACACATATATTCGCNAGATGTGGCGTGTTACGGTGAAAACCTGGCCTATT
TCCCTAAANGGTTTATNGAGAATATGTNTTTCGTCTCAGCCAATCCCTGGGTGAGTTTCACCAGTTTTGATTTAAACGTG
GCCAATATGGACAACTTCTTCGCCCCCGTTTTCACCATGGGCAAATATTATACGCAAGGCGACAAGGTGCTGATGCCGCT
GGCGATTCAGGTTCATCATGCCGTTTGTGATGGCTTCCATGTCGGCAGAATGCTTAATGAATTACAACAGTACTGCGATG
AGTGGCAGGGCGGGGCGTAA

>>MEG_1581|Drugs|Phenicol|Chloramphenicol_acetyltransferases|CATA
ATGACTTTTAATATTATTAATTTAGAAACTTGGGATAGAAAAGAATATTTCAATCATTATTTTAATCAACAAACAACTTA
TAGTGTTACTAAAGAATTAGATATTACCTTGTTAAAAAGTATGATAAAAGATAAAGGATATGAACTGTATCCTGCTTTGA
TTCATGCAATTGTAAGTGTTATAAATCGAAATAAAGTATTTAGAACAGGGATTAATAGTGAGGGGAATTTGGGTTATTGG
GATAAATTAGAACCTTTATATACAGTCTTTAATAAAGAAACTGAAAAATTTTCTAATATTTGGACAGAATCAAATGCTAG
TTTTAACTCTTTTTATAATAGTTATAAGAATGATTTATTTAAATATAAAGATAAAAATGAAATGTTTCCTAAAAAGCCGA
TACCTGAAAACACAGTTCCTATCTCGATGATTCCTTGGATTGATTTTAGTTCATTTAATTTAAATATTGGTAATAATAGT
AGATTTTTATTGCCAATTATTACAATAGGTAAATTTTATAGTAAGGATGATAAGATCTATTTACCATTTTCATTGCAAGT
TCATCATGCAGTATGTGATGGTTACCATGTTTCATTATTTATGAATGAATTTCAAAATATAATTGATAATGTAAATGAAT
GGATTTAA

>>MEG_1582|Drugs|Phenicol|Chloramphenicol_acetyltransferases|CATA
ATGGAGAAAAAAATCACTGGATATACCACCGTTGATATATCCCAATGGCATCGTAAAGAACATTTTGAGGCATTTCAGTC
AGTTGCTCAATGTACCTATAACCAGACCGTTCAGCTGGATATTACGGCTTTCTTAAAAACCGTAAAGAAAAATAAGCACA
AATTTTATCCGGCCTTTATTCACATTCTTGCCCGCCTGATGAATGCTCATCCGGAATTCCGTATGGCAATGAAAGACGGT
GAGCTGGTGATATGGGATAGTGTTCACCCTTGTTACACCGTATTCCATGAGCAAACTGAAACGTTTTCATCGCTCTGGAG
TGAATACCACGACGATTTCCGGCAGTTTCTACACATATATTCGCAAGATATAGCGTGTTACGGTGAAAACCTGGCCTATT
TCCCCAAAGGGTTCATTGAGAATATGTTTTTCGTCTCAGCCAATCCCTGGGTGAGTTTCACCAGTTTTGATTTAAACGTG
GCCAATATGGACAACTTCTTCGCCCCCGTTTTCACCATGGGCAAATATTATACGCAAGGCGACAAGGTGCTGATGCCGCT
GGCGATTCAGGTTCATCATGCCGTTTGTGATGGCTTCCATGTCGGCAGAATGCTTAATGAATTACAACAGTACTGCGATG
AGTGGCAGGGCGGGGCGTAA

>>MEG_1583|Drugs|Phenicol|Chloramphenicol_acetyltransferases|CATA
TTGTTTAAACAAATAGACGAAAATTATCTGCGAAAAGAGCACTTTCACCATTATATGACGTTAACCCGATGCTCATATAG
CTTGGTGATCAATCTAGACATCACGAAATTGCATGCAATATTAAAAGAAAAAAAGCTGAAAGTATATCCTGTGCAAATTT
ATTTGTTAGCAAGAGCTGTGCAAAAAATTCCTGAGTTTCGGATGGATCAAGTGAACGATGAACTTGGTTACTGGGAGATT
CTCCATCCTAGTTATACGATTCTAAATAAAGAAACAAAGACGTTTTCAAGTATTTGGACGCCTTTTGATGAAAACTTTGC
TCAGTTTTATAAAAGCTGTGTAGCCGATATTGAAACATTTAGCAAAAGCAGCAACCTATTTCCGAAACCTCATATGCCAG
AAAACATGTTCAATATTTCAAGTCTACCGTGGATTGATTTTACTTCTTTTAACCTTAATGTATCTACAGATGAAGCTTAT
TTACTGCCTATATTTACGATAGGCAAATTTAAGGTGGAAGAAGGAAAAATCATTTTGCCCGTTGCCATACAAGTACATCA
TGCTGTTTGTGATGGCTATCATGCCGGTCAATATGTTGAATATTTGAGGTGGCTTATTGAACATTGTGACGAGTGGTTAA
ATGATTCATTGCATATTACCTGA

>>MEG_1584|Drugs|Phenicol|Chloramphenicol_acetyltransferases|CATA
ATGGAGAAAAAAATCACTGGATATACCACCGTTGATATATCCCAATGGCATCGTAAAGAACATTTTGAGGCATTTCAGTC
AGTTGCTCAATGTACCTATAACCAGACCGTTCAGCTGGATATTACGGCCTTTTTAAAGACCGTAAAGAAAAATAAGCACA
AGTTTTATCCGGCCTTTATTCACATTCTTGCCCGCCTGATGAATGCTCATCCGGAATTCCGTATGGCAATGAAAGACGGT
GAGCTGGTGATATGGGATAGTGTTCACCCTTGTTACACCGTTTTCCATGAGCAAACTGAAACGTTTTCATCGCTCTGGAG
TGAATACCACGACGATTTCCGGCAGTTTCTACACATATATTCGCAAGATGTGGCGTGTTACGGTGAAAACCTGGCCTATT
TCCCTAAAGGGTTTATTGAGAATATGTTTTTCGTCTCAGCCAATCCCTGGGTGAGTTTCACCAGTTTTGATTTAAACGTG
GCCAATATGGACAACTTCTTCGCCCCCGTTTTCACCATGGGCAAATATTATACGCAAGGCGACAAGGTGCTGATGCCGCT
GGCGATTCAGGTTCATCATGCCGTTTGTGATGGCTTCCATGTCGGCAGAATGCTTAATGAATTACAACAGTACTGCGATG
AGTGGCAGGGCGGGGCGTAA

>>MEG_1585|Drugs|Phenicol|Chloramphenicol_acetyltransferases|CATA
ATGGACACAAAGCGCGTGGGTATATTGGTTGTTGATCTATCCCAATGGGGACGAAAAGAACACTTTGAAGCATTTCAGTC
TTTTGCTCAATGCACCTTTAGCCAGACCGTTCAACTGGATATTACTTCATTATTAAAAACCGTAAAGCAAAATGGGTACA
AATTCTATCCGACATTTATATACATCATTAGCCTATTGGTAAATAAACATGCAGAATTCCGCATGGCAATGAAAGACGGG
GAATTGGTGATATGGGATAGTGTTAACCCTGGGTACAATATCTTTCATGAACAGACCGAAACATTTTCATCTTTATGGAG
TTACTACCACAAAGATATCAATCGTTTTTTGAAAACTTATTCAGAAGATATAGCACAATACGGCGACGATCTAGCCTATT
TTCCAAAAGAATTTATCGAAAATATGTTTTTTGTGTCAGCAAATCCTTGGGTAAGTTTCACCAGTTTTAACTTGAATATG
GCGAATATAAACAATTTCTTTGCCCCTGTATTTACAATAGGTAAATATTATACGCAAGGAGATAAAGTTCTGATGCCACT
AGCAATTCAAGTGCATCATGCCGTATGTGATGGCTTCCATGTAGGCAGATTACTCAATGAAATACAGCAATACTGCGATG
AGGGATGTAAATAA

>>MEG_1586|Drugs|Phenicol|Chloramphenicol_acetyltransferases|CATA
ATGACTTTTAATATTATCAAATTAGAAAATTGGGATAGAAAAGAATATTTTGAACACTATTTTAACCAGCAAACTACGTA
TAGCATTACTAAAGAAATTGATATTACTTTGTTTAAAGATATGATAAAAAAGAAAGGATATGAAATTTATCCTTCTTTGA
TTTATGCAATTATGGAAGTTGTAAATAAAAATAAAGTGTTTAGAACAGGAATTAATAGTGAGAATAAATTAGGCTATTGG
GATAAGTTAAATCCTTTGTATACAGTTTTTAATAAGCAAACTGAAAAATTTACTAACATTTGGACTGAATCTGATAACAA
CTTCACTTCTTTTTATAATAATTATAAAAATGACTTGTTTGAATATAAAGATAAAGAAGAAATGTTTCCTAAAAAACCGA
TACCTGAAAACACCATACCGATTTCAATGATTCCTTGGATTGATTTTAGTTCATTTAATTTAAACATTGGTAACAATAGC
AGCTTTTTATTGCCTATTATTACGATAGGTAAATTTTATAGTGAGAATAATAAAATTTATATACCAGTTGCCTTACAGCT
TCATCATGCTGTATGTGATGGTTACCATGCTTCATTATTTATAAATGAATTTCAAGATATAATTAAGAAGGTAGATGATT
GGATTTAG

>>MEG_1587|Drugs|Phenicol|Chloramphenicol_acetyltransferases|CATA
ATGGAGAAAAAAATCACTGGATATACCACCGTTGATATATCCCAATGGCATCGTAAAGAACATTTTGAGGCATTTCAGTC
AGTTGCTCAATGTACCTATAACCAGACCGTTCAGCTGGATATTACGGCCTTTTTAAAGACCGTAAAGAAAAATAAGCACA
AGTTTTATCCGGCCTTTATTCACATTCTTGCCCGCCTGATGAATGCTCATCCGGAATTCCGTATGGCAATGAAAGACGGT
GAGCTGGTGATATGGGATAGTGTTCACCCTTGTTACACCGTTTTCCATGAGCAAACTGAAACGTTTTCATCGCTCTGGAG
TGAATACCACGACGATTTCCGGCAGTTTCTACACATATATTCGCAAGATGTGGCGTGTTACGGTGAAAACCTGGCCTATT
TCCCTAAAGGGTTTATTGAGAATATGTTTTTCGTCTCAGCCAATCCCTGGGTGAGTTTCACCAGTTTTGATTTAAACGTG
GCCAATATGGACAACTTCTTCGCCCCCGTTTTCACCATGGGCAAATATTATACGCAAGGCGACAAGGTGCTGATGCCGCT
GGCGATTCAGGTTCATCATGCCGTCTGTGATGGCTTCCATGTCGGCAGAATGCTTAATGAATTACAACAGTACTGCGATG
AGTGGCAGGGCGGGGCGTAA

>>MEG_1588|Drugs|Phenicol|Chloramphenicol_acetyltransferases|CATA
ATGAACTATACAAAATTTGATGTAAAAAATTGGGTTCGCCGTGAGCATTTTGAGTTTTATCGGCATCGTTTACCATGTGG
TTTTAGCTTAACAAGCAAAATTGATATCACGACGTTAAAAAAGTCATTGGATGATTCAGCGTATAAGTTTTATCCGGTAA
TGATCTATCTGATTGCTCAGGCCGTGAATCAATTTGATGAGTTGAGAATGGCGATAAAAGATGATGAATTGATCGTATGG
GATTCAGTCGACCCACAATTCACCGTATTCCATCAAGAAACAGAGACATTTTCAGCACTGAGTTGCCCATACTCATCCGA
TATTGATCAATTTATGGTGAATTATTTATCGGTAATGGAACGTTATAAAAGTGATACCAAGTTATTTCCTCAAGGGGTAA
CACCAGAAAATCATTTAAATATTTCAGCATTACCTTGGGTTAATTTTGATAGCTTTAATTTAAATGTTGCTAATTTTACC
GATTATTTTGCACCCATTATAACAATGGCAAAATATCAGCAAGAAGGGGATAGACTGTTATTGCCGCTCTCAGTACAGGT
TCATCATGCAGTTTGTGATGGCTTCCATGTTGCACGCTTTATTAATCGGCTACAAGAGTTGTGTAACAGTAAATTAAAAT
AA

>>MEG_1589|Drugs|Phenicol|Chloramphenicol_acetyltransferases|CATA
ATGAATTTTACCCGGATTGACCTGAATACCTGGAATCGCAGGGAACACTTTGCCCTTTATCGTCAGCAGATTAAATGCGG
ATTCAGCCTGACCACCAAACTCGATATTACCGCTTTGCGTACCGCACTGGCGGAGACAGGTTATAAGTTTTATCCGCTGA
TGATTTACCTGATCTCCCGGGCTGTTAATCAGTTTCCGGAGTTCCGGATGGCACTGAAAGACAATGAACTTATTTACTGG
GACCAGTCAGACCCGGTCTTTACTGTCTTTCATAAAGAAACCGAAACATTCTCTGCACTGTCCTGCCGTTATTTTCCGGA
TCTCAGTGAGTTTATGGCAGGTTATAATGCGGTAACGGCAGAATATCAGCATGATACCAGATTGTTTCCGCAGGGAAATT
TACCGGAGAATCACCTGAATATATCATCATTACCGTGGGTGAGTTTTGACGGATTTAACCTGAACATCACCGGAAATGAT
GATTATTTTGCCCCGGTTTTTACGATGGCAAAGTTTCAGCAGGAAGGTGACCGCGTATTATTACCTGTTTCTGTACAGGT
TCATCATGCAGTATGTGATGGCTTTCATGCAGCACGGTTTATTAATACACTTCAGCTGATGTGTGATAACATACTGAAAT
AA

>>MEG_1590|Drugs|Phenicol|Chloramphenicol_acetyltransferases|CATA
ATGAATTTTACCAGAATTGATCTGAACACCTGGAACCGCAGAGAACATTTTGCTCTTTATCGTCAGCAGATAAAATGCGG
ATTCAGCCTGACCACAAAACTCGATATTACAGCTTTTCGTACCGCACTGGCGGAAACGGATTATAAATTTTATCCGGTGA
TGATTTATCTGATCTCCCGGGTTGTTAATCAGTTTCCGGAGTTCCGGATGGCAATGAAAGATAATGCACTGATTTACTGG
GATCAGACCGATCCTGTATTTACTGTTTTTCATAAAGAGACTGAAACATTTTCTGCGCTCTTCTGCCGTTATTGTCCGGA
TATCAGTGAATTTATGGCGGGCTATAATGCGGTGATGGCAGAATATCAGCATAATACTGCATTGTTCCCGCAGGGAGCGT
TACCAGAGAACCACCTGAATATATCATCATTACCCTGGGTGAGTTTTGACGGATTTAACCTGAATATCACCGGTAATGAT
GATTATTTTGCTCCGGTGTTTACTATGGCGAAATTTCAGCAGGAAGATAACCGCGTATTATTACCTGTTTCTGTACAGGT
ACATCATGCCGTTTGTGATGGCTTTCATGCAGCCAGGTTTATTAATACACTTCAGATGATGTGTGATAACATACTGAAAT
AA

>>MEG_1591|Drugs|Phenicol|Chloramphenicol_acetyltransferases|CATA
ATGACTTTTAATATTATTGAATTAGAAAATTGGGATAGAAAAGAATATTTTGAACACTATTTTAATCAGCAAACTACTTA
TAGCATTACTAAAGAAATTGATATTACTTTGTTTAAAGATATGATAAAAAAGAAAGGATATGAAATTTATCCCTCTTTAA
TTTATGCAATTATGGAAGTTGTAAATAAAAATAAAGTGTTTAGAACAGGAATTAATAGTGAGAATAAATTAGGTTATTGG
GATAAGTTAAATCCTTTGTATACAGTTTTTAATAAGCAAACTGAAAAATTTACTAACATTTGGACTGAATCTGATAAAAA
CTTCATTTCTTTTTATAATAATTATAAAAATGACTTGCTTGAATATAAAGATAAAGAAGAAATGTTTCCTAAAAAACCGA
TACCTGAAAACACCATACCGATTTCAATGATTCCTTGGATTGATTTTAGTTCATTTAATTTAAATATTGGTAACAATAGC
AGCTTTTTATTGCCTATTATTACGATAGGTAAATTTTATAGTGAGAATAATAAAATTTATATACCAGTTGCTCTGCAACT
TCATCATTCTGTATGTGATGGTTACCATGCTTCACTATTTATGAATGAATTTCAAGATATAATTCATAGGGTAGATGATT
GGATTTAG

>>MEG_1592|Drugs|Phenicol|Chloramphenicol_acetyltransferases|CATA
ATGGAGAAAAAAATCACTGGATATACCACCGTTGATATATCCCAATGGCATCGTAAAGAACATTTTGAGGCATTTCAGTC
AGTTGCTCAATGTACCTATAACCAGACCGTTCAGCTGGATATTACGGCCTTTTTAAAGACCGTAAAGAAAAATAAGCACA
AGTTTTATCCGGCCTTTATTCACATTCTTGCCCGCCTGATGAATGCTCATCCGGAATTCCGTATGGCAATGAAAGACGGT
GAGCTGGTGATATGGGATAGTATTCACCCTTGTTACACCGTTTTCCATGAGCAAACTGAAACGTTTTCATCGCTCTGGAG
TGAATACCACGACGATTTCCGGCAGTTTCTACACATATATTCGCAAGATGTGGCGTGTTACGGTGAAAACCTGGCCTATT
TCCCTAAAGGGTTTATTGAGAATATGTTTTTCGTCTCAGCCAATCCCTGGGTGAGTTTCACCAGTTTTGATTTAAACGTG
GCCAATATGGACAACTTCTTCGCCCCCGTTTTCACCATGGGCAAATATTATACGCAAGGCGACAAGGTGCTGATGCCGCT
GGCGATTCAGGTTCATCATGCCGTTTGTGATGGCTTCCATGTCGGCAGAATGCTTAATGAATTACAACAGTACTGCAATG
AGTGGCAGGGCGGGGCGTAA

>>MEG_1593|Drugs|Phenicol|Chloramphenicol_acetyltransferases|CATA
AGGAAGCTAAAATGGAGAAAAAAATCACTGGATATACCACCGTTGATATATCCCAATGGCATCGTAAAGAACATTTTGAG
GCATTTCAGTCAGTTGCTCAATGTACCTATAACCAGACCGTTCAGCTGGATATTACGGCCTTTTTAAAGACCGTAAAGAA
AAATAAGCACAAGTTTTATCCGGCCTTTATTCACATTCTTGCCCGCCTGATGAATGCTCATCCGGAATTCCGTATGGCAA
TGAAAGACGGTGAGCTGGTGATATGGGATAGTGTTCACCCTTGTTACACCGTTTTCCATGAGCAAACTGAAACGTTTTCA
TCGCTCTGGAGTGAATACCACGACGATTTCCGGCAGTTTCTACACATATATTCGCAAGATGTGGCGTGTTACGGTGAAAA
CCTGGCCTATTTCCCTAAAGGGTTTATTGAGAATATGTTTTTCGTCTCAGCCAATCCCTGGGTGAGTTTCACCAGTTTTG
ATTTAAACGTGGCCAATATGGACAACTTCTTCGCCCCCGTTTTCACCATGGGCAAATATTATACGCAAGGCGACAAGGTG
CTGATGCCGCTGGCGATTCAGGTTCATCATGCCGTTTGTGATGGCTTCCATGTCGGCAGAATGCTTAATGAATTACAACA
GTACTGCGATGAGTGGCAGGGCGGGGCGTAA