MEGAResFrom MEG, the Microbial Ecology Group

Notice: Trying to access array offset on value of type null in /home/meglabuser/megares.meglab.org/vendor/doctrine/annotations/lib/Doctrine/Common/Annotations/DocParser.php on line 967

TMRB

The tmrB gene encodes a membrane bound enzyme that binds ATP, however the direct mechanism of action that causes resistane to tunicamycin is not currently known.

References

  • http://www.readcube.com/articles/10.2323/jgam.42.343

Notice: Trying to access array offset on value of type null in /home/meglabuser/megares.meglab.org/vendor/doctrine/annotations/lib/Doctrine/Common/Annotations/DocParser.php on line 967

Sequences

Download Sequences

>>MEG_7262|Drugs|Nucleosides|Tunicamycin_resistance_protein|TMRB
ATGATCATTTGGATAAACGGGGCATTCGGTTCGGGAAAAACACAAACAGCCTTCGAACTGCACAGAAGGCTGAACCCATC
TTACGTGTATGATCCCGAGAAAATGGGTTTTGCGCTGCGCTCCATGGTGCCGCAGGAGATCGCAAAGGACGATTTTCAAA
GCTATCCTTTATGGCGGGCGTTCAATTACAGTTTGCTAGCTTCTCTGACAGATACATACCGCGGCATCCTTATTGTGCCT
ATGACGATTGTACACCCTGAATACTTCAATGAGATCATCGGCAGGCTCAGACAGGAAGGCAGGATCGTTCACCACTTTAC
ACTAATGGCTTCAAAGGAAACCTTGTTAAAAAGGCTGCGCACCAGAGCAGAAGGAAAAAACTCATGGGCCGCCAAACAAA
TTGACCGCTGTGTTGAAGGATTATCATCACCCATTTTTGAGGACCACATTCAAACAGACAACCTGTCGATTCAGGATGTG
GCAGAGAACATTGCCGCGAGAGCCGAACTCCCATTAGATCCTGATACAAGAGGCAGCCTCCGAAGGTTCGCCGACAGATT
AATGGTAAAGCTGAATCATATCCGCATCAAATAA