Warning: "continue" targeting switch is equivalent to "break". Did you mean to use "continue 2"? in /home/meglabuser/megares.meglab.org/vendor/doctrine/orm/lib/Doctrine/ORM/UnitOfWork.php on line 2640

Deprecated: The behavior of unparenthesized expressions containing both '.' and '+'/'-' will change in PHP 8: '+'/'-' will take a higher precedence in /home/meglabuser/megares.meglab.org/src/Sequence.php on line 169

Warning: Cannot modify header information - headers already sent by (output started at /home/meglabuser/megares.meglab.org/vendor/doctrine/orm/lib/Doctrine/ORM/UnitOfWork.php:2640) in /home/meglabuser/megares.meglab.org/browse/download.php on line 41

Warning: Cannot modify header information - headers already sent by (output started at /home/meglabuser/megares.meglab.org/vendor/doctrine/orm/lib/Doctrine/ORM/UnitOfWork.php:2640) in /home/meglabuser/megares.meglab.org/browse/download.php on line 42

Warning: Cannot modify header information - headers already sent by (output started at /home/meglabuser/megares.meglab.org/vendor/doctrine/orm/lib/Doctrine/ORM/UnitOfWork.php:2640) in /home/meglabuser/megares.meglab.org/browse/download.php on line 43

Warning: Cannot modify header information - headers already sent by (output started at /home/meglabuser/megares.meglab.org/vendor/doctrine/orm/lib/Doctrine/ORM/UnitOfWork.php:2640) in /home/meglabuser/megares.meglab.org/browse/download.php on line 44

Warning: Cannot modify header information - headers already sent by (output started at /home/meglabuser/megares.meglab.org/vendor/doctrine/orm/lib/Doctrine/ORM/UnitOfWork.php:2640) in /home/meglabuser/megares.meglab.org/browse/download.php on line 45

Warning: Cannot modify header information - headers already sent by (output started at /home/meglabuser/megares.meglab.org/vendor/doctrine/orm/lib/Doctrine/ORM/UnitOfWork.php:2640) in /home/meglabuser/megares.meglab.org/browse/download.php on line 46
>>MEG_2709|Drugs|Mycobacterium_tuberculosis-specific_Drug|Ethambutol_resistant_arabinosyltransferase|EMBA|RequiresSNPConfirmation GTGCCCCACGACGGTAATGAGCGATCTCACCGGATCGCACGCCTAGCAGCCGTCGTCTCGGGAATCGCGGGTCTGCTGCTGTGCGGCATCGTTCCGCTGCTTCCGGTGAACCAAACCACCGCGACCATCTTCTGGCCGCAGGGCAGCACCGCCGACGGCAACATCACCCAGATCACCGCCCCTCTGGTATCCGGGGCGCCACGCGCGCTGGACATCTCGATCCCCTGCTCGGCCATCGCCACGCTGCCCGCCAACGGCGGCCTGGTGCTGTCCACACTGCCGGCCGGTGGCGTGGATACCGGTAAGGCCGGGCTGTTCGTCCGCGCCAACCAGGACACGGTCGTCGTGGCGTTCCGCGACTCGGTGGCCGCGGTGGCGGCCCGCTCCACGATCGCAGCGGGAGGCTGTAGCGCGCTGCATATCTGGGCCGATACCGGCGGCGCGGGCGCTGATTTTATGGGTATACCCGGCGGCGCCGGGACCCTGCCGCCGGAGAAGAAGCCACAGGTTGGCGGCATCTTCACCGACCTGAAGGTCGGAGCGCAGCCCGGGCTGTCGGCCCGCGTCGACATCGACACTCGGTTTATCACGACGCCCGGCGCGCTCAAGAAGGCCGTGATGCTCCTCGGCGTGCTGGCGGTCCTGGTAGCCATGGTGGGGCTGGCCGCGCTGGACCGGCTCAGCAGGGGCCGCACCCTGCGCGACTGGCTGACCCGATATCGCCCGCGGGTGCGGGTCGGATTCGCCAGCCGGCTCGCTGACGCAGCGGTGATCGCGACCTTGTTGCTCTGGCATGTCATCGGCGCCACCTCGTCCGATGACGGCTACCTTCTGACCGTCGCCCGGGTCGCCCCGAAGGCCGGCTATGTAGCCAACTACTACCGGTATTTCGGCACGACGGAGGCGCCGTTCGACTGGTATACATCGGTGCTTGCCCAGCTGGCGGCGGTGAGCACCGCCGGCGTCTGGATGCGCCTGCCCGCCACCCTGGCCGGAATCGCCTGCTGGCTGATCGTCAGCCGTTTCGTGCTGCGGCGGCTGGGACCGGGCCCGGGCGGGCTGGCGTCCAACCGGGTCGCTGTGTTCACCGCTGGTGCGGTGTTCCTGTCCGCCTGGCTGCCGTTCAACAACGGCCTGCGTCCCGAGCCGCTGATCGCGCTGGGTGTGCTGGTCACGTGGGTGTTGGTGGAACGGTCGATCGCGCTCGGACGGCTGGCCCCGGCCGCGGTAGCCATCATCGTGGCGACGCTTACCGCGACGCTGGCACCGCAGGGGTTGATCGCGCTGGCCCCGCTGCTGACTGGTGCGCGCGCCATCGCCCAGAGGATCCGGCGCCGCCGGGCGACCGATGGACTGCTGGCGCCGCTGGCGGTGCTGGCCGCGGCGTTGTCGCTGATCACCGTGGTGGTGTTTCGGGACCAGACGCTGGCCACGGTGGCCGAATCGGCACGCATCAAGTACAAGGTCGGCCCGACCATCGCCTGGTACCAGGACTTCCTGCGCTACTACTTCCTTACCGTGGAGAGCAACGTTGAGGGGTCGATGTCCCGCCGGTTCGCGGTGCTGGTGTTGCTGTTCTGCCTGTTCGGGGTGCTGTTCGTGCTGCTGCGGCGCGGCCGGGTGGCGGGGCTGGCCAGCGGCCCGGCCTGGCGACTGATCGGCACTACGGCGGTCGGCCTGCTGCTGCTCACGTTCACGCCAACCAAGTGGGCCGTGCAGTTCGGCGCATTCGCCGGGCTGGCCGGGGTGTTGGGTGCGGTCACCGCGTTCACCTTTGCCCGCATCGGTCTACATAGTCGACGCAACCTCACGCTGTACGTGACCGCGTTGCTGTTCGTGCTGGCGTGGGCAACCTCGGGCATCAACGGGTGGTTCTACGTCGGCAACTACGGGGTGCCGTGGTATGACATCCAGCCCGTCATCGCCAGCCACCCGGTGACGTCGATGTTTCTGACGCTGTCGATCCTCACCGGATTGCTGGCAGCCTGGTATCACTTCCGGATGGACTACGCCGGGCACACCGAAGTCAAAGACAACCGGCGCAACCGCATCTTGGCCTCTACGCCACTGCTGGTGGTCGCGGTGATCATGGTCGCAGGCGAAGTCGGCTCGATGGCCAAGGCCGCGGTGTTCCGTTACCCGCTTTACACCACCGCCAAGGCCAACCTGACCGCGCTCAGCACCGGGCTGTCCAGCTGTGCGATGGCCGACGACGTGCTGGCCGAGCCCGACCCCAATGCCGGCATGCTGCAACCGGTTCCGGGCCAGGCGTTCGGACCGGACGGACCGCTGGGCGGTATCAGTCCCGTCGGCTTCAAACCCGAGGGCGTGGGCGAGGACCTCAAGTCCGACCCGGTGGTCTCCAAACCCGGGCTGGTCAACTCCGATGCGTCGCCCAACAAACCCAACGCCGCCATCACCGACTCCGCGGGCACCGCCGGAGGGAAGGGCCCGGTCGGGATCAACGGGTCGCACGCGGCGCTGCCGTTCGGATTGGACCCGGCACGTACCCCGGTGATGGGCAGCTACGGGGAGAACAACCTGGCCGCCACGGCCACCTCGGCCTGGTACCAGTTACCGCCCCGCAGCCCGGACCGGCCGCTGGTGGTGGTTTCCGCGGCCGGCGCCATCTGGTCCTACAAGGAGGACGGCGATTTCATCTACGGCCAGTCCCTGAAACTGCAGTGGGGCGTCACCGGCCCGGACGGCCGCATCCAGCCACTGGGGCAGGTATTTCCGATCGACATCGGACCGCAACCCGCGTGGCGCAATCTGCGGTTTCCGCTGGCCTGGGCGCCGCCGGAGGCCGACGTGGCGCGCATTGTCGCCTATGACCCGAACCTGAGCCCTGAGCAATGGTTCGCCTTCACCCCGCCCCGGGTTCCGGTGCTGGAATCTCTGCAGCGGTTGATCGGGTCAGCGACACCGGTGTTGATGGACATCGCGACCGCAGCCAACTTCCCCTGCCAGCGACCGTTTTCCGAGCATCTCGGCATTGCCGAGCTTCCGCAGTACCGGATCCTGCCGGACCACAAGCAGACGGCGGCGTCGTCGAACCTATGGCAGTCCAGCTCGACCGGCGGTCCGTTCCTGTTCACCCAGGCGCTGCTGCGCACCTCGACGATCGCCACGTACCTGCGTGGGGACTGGTATCGCGACTGGGGATCGGTGGAGCAGTACCACCGGCTGGTGCCGGCCGATCAGGCTCCAGACGCCGTTGTCGAGGAGGGCGTGATCACTGTGCCCGGCTGGGGTCGGCCAGGACCGATCAGGGCGCTGCCATGA >>MEG_2710|Drugs|Mycobacterium_tuberculosis-specific_Drug|Ethambutol_resistant_arabinosyltransferase|EMBB|RequiresSNPConfirmation ATGACACAGTGCGCGAGCAGACGCAAAAGCACCCCAAATCGGGCGATTTTGGGGGCTTTTGCGTCTGCTCGCGGGACGCGCTGGGTGGCCACCATCGCCGGGCTGATTGGCTTTGTGTTGTCGGTGGCGACGCCGCTGCTGCCCGTCGTGCAGACCACCGCGATGCTCGACTGGCCACAGCGGGGGCAACTGGGCAGCGTGACCGCCCCGCTGATCTCGCTGACGCCGGTCGACTTTACCGCCACCGTGCCGTGCGACGTGGTGCGCGCCATGCCACCCGCGGGCGGGGTGGTGCTGGGCACCGCACCCAAGCAAGGCAAGGACGCCAATTTGCAGGCGTTGTTCGTCGTCGTCAGCGCCCAGCGCGTGGACGTCACCGACCGCAACGTGGTGATCTTGTCCGTGCCGCGCGAGCAGGTGACGTCCCCGCAGTGTCAACGCATCGAGGTCACCTCTACCCACGCCGGCACCTTCGCCAACTTCGTCGGGCTCAAGGACCCGTCGGGCGCGCCGCTGCGCAGCGGCTTCCCCGACCCCAACCTGCGCCCGCAGATTGTCGGGGTGTTCACCGACCTGACCGGGCCCGCGCCGCCCGGGCTGGCGGTCTCGGCGACCATCGACACCCGGTTCTCCACCCGGCCGACCACGCTGAAACTGCTGGCGATCATCGGGGCGATCGTGGCCACCGTCGTCGCACTGATCGCGTTGTGGCGCCTGGACCAGTTGGACGGGCGGGGCTCAATTGCCCAGCTCCTCCTCAGGCCGTTCCGGCCTGCATCGTCGCCGGGCGGCATGCGCCGGCTGATTCCGGCAAGCTGGCGCACCTTCACCCTGACCGACGCCGTGGTGATATTCGGCTTCCTGCTCTGGCATGTCATCGGCGCGAATTCGTCGGACGACGGCTACATCCTGGGCATGGCCCGAGTCGCCGACCACGCCGGCTACATGTCCAACTATTTCCGCTGGTTCGGCAGCCCGGAGGATCCCTTCGGCTGGTATTACAACCTGCTGGCGCTGATGACCCATGTCAGCGACGCCAGTCTGTGGATGCGCCTGCCAGACCTGGCCGCCGGGCTAGTGTGCTGGCTGCTGCTGTCGCGTGAGGTGCTGCCCCGCCTCGGGCCGGCGGTGGAGGCCAGCAAACCCGCCTACTGGGCGGCGGCCATGGTCTTGCTGACCGCGTGGATGCCGTTCAACAACGGCCTGCGGCCGGAGGGCATCATCGCGCTCGGCTCGCTGGTCACCTATGTGCTGATCGAGCGGTCCATGCGGTACAGCCGGCTCACACCGGCGGCGCTGGCCGTCGTTACCGCCGCATTCACACTGGGTGTGCAGCCCACCGGCCTGATCGCGGTGGCCGCGCTGGTGGCCGGCGGCCGCCCGATGCTGCGGATCTTGGTGCGCCGTCATCGCCTGGTCGGCACGTTGCCGTTGGTGTCGCCGATGCTGGCCGCCGGCACCGTCATCCTGACCGTGGTGTTCGCCGACCAGACCCTGTCAACGGTGTTGGAAGCCACCAGGGTTCGCGCCAAAATCGGGCCGAGCCAGGCGTGGTATACCGAGAACCTGCGTTACTACTACCTCATCCTGCCCACCGTCGACGGTTCGCTGTCGCGGCGCTTCGGCTTTTTGATCACCGCGCTATGCCTGTTCACCGCGGTGTTCATCATGTTGCGGCGCAAGCGAATTCCCAGCGTGGCCCGCGGACCGGCGTGGCGGCTGATGGGCGTCATCTTCGGCACCATGTTCTTCCTGATGTTCACGCCCACCAAGTGGGTGCACCACTTCGGGCTGTTCGCCGCCGTAGGGGCGGCGATGGCCGCGCTGACGACGGTGTTGGTATCCCCATCGGTGCTGCGCTGGTCGCGCAACCGGATGGCGTTCCTGGCGGCGTTATTCTTCCTGCTGGCGTTGTGTTGGGCCACCACCAACGGCTGGTGGTATGTCTCCAGCTACGGTGTGCCGTTCAACAGCGCGATGCCGAAGATCGACGGGATCACAGTCAGCACAATCTTTTTCGCCCTGTTTGCGATCGCCGCCGGCTATGCGGCCTGGCTGCACTTCGCGCCCCGCGGCGCCGGCGAAGGGCGGCTGATCCGCGCGCTGACGACAGCCCCGGTACCGATCGTGGCCGGTTTCATGGCGGCGGTGTTCGTCGCGTCCATGGTGGCCGGGATCGTGCGACAGTACCCGACCTACTCCAACGGCTGGTCCAACGTGCGGGCGTTTGTCGGCGGCTGCGGACTGGCCGACGACGTACTCGTCGAGCCTGATACCAATGCGGGTTTCATGAAGCCGCTGGACGGCGATTCGGGTTCTTGGGGCCCCTTGGGCCCGCTGGGTGGAGTCAACCCGGTCGGCTTCACGCCCAACGGCGTACCGGAACACACGGTGGCCGAGGCGATCGTGATGAAACCCAACCAGCCCGGCACCGACTACGACTGGGATGCGCCGACCAAGCTGACGAGTCCTGGCATCAATGGTTCTACGGTGCCGCTGCCCTATGGGCTCGATCCCGCCCGGGTACCGTTGGCAGGCACCTACACCACCGGCGCACAGCAACAGAGCACACTCGTCTCGGCGTGGTATCTCCTGCCTAAGCCGGACGACGGGCATCCGCTGGTCGTGGTGACCGCCGCGGGCAAGATCGCCGGCAACAGCGTGCTGCACGGGTACACCCCCGGGCAGACTGTGGTGCTCGAATACGCCATGCCGGGACCCGGAGCGCTGGTACCCGCCGGGCGGATGGTGCCCGACGACCTATACGGAGAGCAGCCCAAGGCGTGGCGCAACCTGCGCTTCGCCCGAGCAAAGATGCCCGCCGATGCCGTCGCGGTCCGGGTGGTGGCCGAGGATCTGTCGCTGACACCGGAGGACTGGATCGCGGTGACCCCGCCGCGGGTACCGGACCTGCGCTCACTGCAGGAATATGTGGGCTCGACGCAGCCGGTGCTGCTGGACTGGGCGGTCGGTTTGGCCTTCCCGTGCCAGCAGCCGATGCTGCACGCCAATGGCATCGCCGAAATCCCGAAGTTCCGCATCACACCGGACTACTCGGCTAAGAAGCTGGACACCGACACGTGGGAAGACGGCACTAACGGCGGCCTGCTCGGGATCACCGACCTGTTGCTGCGGGCCCACGTCATGGCCACCTACCTGTCCCGCGACTGGGCCCGCGATTGGGGTTCCCTGCGCAAGTTCGACACCCTGGTCGATGCCCCTCCCGCCCAGCTCGAGTTGGGCACCGCGACCCGCAGCGGCCTGTGGTCACCGGGCAAGATCCGAATTGGTCCATAG >>MEG_2711|Drugs|Mycobacterium_tuberculosis-specific_Drug|Ethambutol_resistant_arabinosyltransferase|EMBB|RequiresSNPConfirmation ATGACACAGTGCGCGAGCAGACGCAAAAGCACCCCAAGTCGGGCGATTTTGGGGGCTTTTGCGTCTGCTCGCGGGACGCGCTGGGTGGCCACCATCGCCGGGCTGATTGGCTTTGTGTTGTCGGTGGCGACGCCGCTGCTGCCCGTCGTGCAGACCACCGCGATGCTCGACTGGCCACAGCGGGGGCAACTGGGCAGCGTGACCGCCCCGCTGATCTCGCTGACGCCGGTCGACTTTACCGCCACCGTGCCGTGCGACGTGGTGCGCGCCATGCCACCCGCGGGCGGGGTGGTGCTGGGCACCGCACCCAAGCAAGGCAAGGACGCCAATTTGCAGGCGTTGTTCGTCGTTGTCAGCGCCCAGCGCGTGGACGTCACCGACCGCAACGTGGTGATCTTGTCCGTGCCGCGCGAGCAGGTGACGTCCCCGCAGTGTCAACGCATCGAGGTCACCTCTACCCACGCCGGCACCTTCGCCAACTTCGTCGGGCTCAAGGACCCGTCGGGCGCGCCGCTGCGCAGCGGCTTCCCCGACCCCAACCTGCGCCCGCAGATTGTCGGGGTGTTCACCGACCTGACCGGGCCCGCGCCGCCCGGGCTGGCGGTCTCGGCGACCATCGACACCCGGTTCTCCACCCGGCCGACCACGCTGAAACTGCTGGCGATCATCGGGGCGATCGTGGCCACCGTCGTCGCACTGATCGCGTTGTGGCGCCTGGACCAGTTGGACGGGCGGGGCTCAATTGCCCAGCTCCTCCTCAGGCCGTTCCGGCCTGCATCGTCGCCGGGCGGCATGCGCCGGCTGATTCCGGCAAGCTGGCGCACCTTCACCCTGACCGACGCCGTGGTGATATTCGGCTTCCTGCTCTGGCATGTCATCGGCGCGAATTCGTCGGACGACGGCTACATCCTGGGCATGGCCCGAGTCGCCGACCACGCCGGCTACATGTCCAACTATTTCCGCTGGTTCGGCAGCCCGGAGGATCCCTTCGGCTGGTATTACAACCTGCTGGCGCTGATGACCCATGTCAGCGACGCCAGTCTGTGGATGCGCCTGCCAGACCTGGCCGCCGGGCTAGTGTGCTGGCTGCTGCTGTCGCGTGAGGTGCTGCCCCGCCTCGGGCCGGCGGTGGCGGCCAGCAAACCCGCCTACTGGGCGGCGGCCATGGTCTTGCTGACCGCGTGGATGCCGTTCAACAACGGCCTGCGGCCGGAGGGCATCATCGCGCTCGGCTCGCTGGTCACCTATGTGCTGATCGAGCGGTCCATGCGGTACAGCCGGCTCACACCGGCGGCGCTGGCCGTCGTTACCGCCGCATTCACACTGGGTGTGCAGCCCACCGGCCTGATCGCGGTGGCCGCGCTGGTGGCCGGCGGCCGCCCGATGCTGCGGATCTTGGTGCGCCGTCATCGCCTGGTCGGCACGTTGCCGTTGGTGTCGCCGATGCTGGCCGCCGGCACCGTCATCCTGACCGTGGTGTTCGCCGACCAGACCCTGTCAACGGTGTTGGAAGCCACCAGGGTTCGCGCCAAAATCGGGCCGAGCCAGGCGTGGTATACCGAGAACCTGCGTTACTACTACCTCATCCTGCCCACCGTCGACGGTTCGCTGTCGCGGCGCTTCGGCTTTTTGATCACCGCGCTATGCCTGTTCACCGCGGTGTTCATCATGTTGCGGCGCAAGCGAATTCCCAGCGTGGCCCGCGGACCGGCGTGGCGGCTGATGGGCGTCATCTTCGGCACCATGTTCTTCCTGATGTTCACGCCCACCAAGTGGGTGCACCACTTCGGGCTGTTCGCCGCCGTAGGGGCGGCGATGGCCGCGCTGACGACGGTGTTGGTATCCCCATCGGTGCTGCGCTGGTCGCGCAACCGGATGGCGTTCCTGGCGGCGTTATTCTTCCTGCTGGCGTTGTGTTGGGCCACCACCAACGGCTGGTGGTATGTCTCCAGCTACGGTGTGCCGTTCAACAGCGCGATGCCGAAGATCGACGGGATCACAGTCAGCACAATCTTTTTCGCCCTGTTTGCGATCGCCGCCGGCTATGCGGCCTGGCTGCACTTCGCGCCCCGCGGCGCCGGCGAAGGGCGGCTGATCCGCGCGCTGACGACAGCCCCGGTACCGATCGTGGCCGGTTTCATGGCGGCGGTGTTCGTCGCGTCCATGGTGGCCGGGATCGTGCGACAGTACCCGACCTACTCCAACGGCTGGTCCAACGTGCGGGCGTTTGTCGGCGGCTGCGGACTGGCCGACGACGTACTCGTCGAGCCTGATACCAATGCGGGTTTCATGAAGCCGCTGGACGGCGATTCGGGTTCTTGGGGCCCCTTGGGCCCGCTGGGTGGAGTCAACCCGGTCGGCTTCACGCCCAACGGCGTACCGGAACACACGGTGGCCGAGGCGATCGTGATGAAACCCAACCAGCCCGGCACCGACTACGACTGGGATGCGCCGACCAAGCTGACGAGTCCTGGCATCAATGGTTCTACGGTGCCGCTGCCCTATGGGCTCGATCCCGCCCGGGTACCGTTGGCAGGCACCTACACCACCGGCGCACAGCAACAGAGCACACTCGTCTCGGCGTGGTATCTCCTGCCTAAGCCGGACGACGGGCATCCGCTGGTCGTGGTGACCGCCGCGGGCAAGATCGCCGGCAACAGCGTGCTGCACGGGTACACCCCCGGGCAGACTGTGGTGCTCGAATACGCCATGCCGGGACCCGGAGCGCTGGTACCCGCCGGGCGGATGGTGCCCGACGACCTATACGGAGAGCAGCCCAAGGCGTGGCGCAACCTGCGCTTCGCCCGAGCAAAGATGCCCGCCGATGCCGTCGCGGTCCGGGTGGTGGCCGAGGATCTGTCGCTGACACCGGAGGACTGGATCGCGGTGACCCCGCCGCGGGTACCGGACCTGCGCTCACTGCAGGAATATGTGGGCTCGACGCAGCCGGTGCTGCTGGACTGGGCGGTCGGTTTGGCCTTCCCGTGCCAGCAGCCGATGCTGCACGCCAATGGCATCGCCGAAATCCCGAAGTTCCGCATCACACCGGACTACTCGGCTAAGAAGCTGGACACCGACACGTGGGAAGACGGCACTAACGGCGGCCTGCTCGGGATCACCGACCTGTTGCTGCGGGCCCACGTCATGGCCACCTACCTGTCCCGCGACTGGGCCCGCGATTGGGGTTCCCTGCGCAAGTTCGACACCCTGGTCGATGCCCCTCCCGCCCAGCTCGAGTTGGGCACCGCGACCCGCAGCGGCCTGTGGTCACCGGGCAAGATCCGAATTGGTCCATAG >>MEG_2712|Drugs|Mycobacterium_tuberculosis-specific_Drug|Ethambutol_resistant_arabinosyltransferase|EMBC|RequiresSNPConfirmation ATGGCTACCGAAGCCGCCCCACCCCGTATCGCCGTCCGGCTACCATCTACCTCCGTGCGCGACGCGGGAGCAAACTACCGGATCGCCCGGTACGTCGCTGTGGTGGCGGGTCTGCTAGGCGCTGTGCTGGCCATCGCCACCCCACTGCTGCCGGTCAACCAGACCACCGCGCAATTGAACTGGCCCCAAAACGGCACGTTCGCCAGTGTCGAGGCACCGCTGATTGGCTACGTGGCCACCGACTTGAACATCACCGTCCCCTGCCAGGCCGCCGCCGGACTGGCCGGATCGCAGAACACCGGCAAGACGGTGTTGTTGTCAACGGTGCCCAAGCAGGCGCCTAAGGCCGTCGATCGCGGGCTGCTGCTGCAACGGGCCAACGACGACCTGGTGCTTGTGGTGCGTAATGTCCCGTTGGTCACCGCCCCGCTGAGTCAGGTGCTCGGCCCGACCTGTCAGCGGTTGACATTCACCGCGCACGCCGATCGGGTCGCCGCCGAATTCGTCGGACTGGTGCAGGGACCCAATGCTGAGCACCCCGGTGCACCGCTGCGCGGTGAGCGCAGCGGCTACGACTTCCGCCCGCAGATCGTCGGGGTGTTCACCGACCTGGCCGGGCCGGCGCCACCGGGTCTGAGCTTCTCGGCGAGCGTGGATACCCGCTACAGCAGCAGCCCCACGCCGCTGAAGATGGCCGCCATGATCCTCGGGGTAGCGCTCACCGGCGCCGCCCTGGTGGCGCTGCACATCCTGGACACCGCCGACGGCATGCGGCACCGGCGGTTCCTGCCCGCGCGCTGGTGGTCGACCGGCGGTCTGGACACCCTGGTTATCGCCGTGCTGGTGTGGTGGCATTTCGTCGGGGCCAACACCTCCGACGACGGCTACATCCTGACCATGGCCCGGGTGTCCGAGCATGCGGGCTATATGGCCAACTACTACCGCTGGTTCGGCACACCCGAGGCGCCTTTCGGCTGGTACTACGACCTGCTGGCGCTGTGGGCTCATGTCAGCACGGCCAGTATCTGGATGCGCCTACCCACCCTGGCGATGGCGCTCACCTGCTGGTGGGTAATCAGCCGTGAGGTCATTCCCCGGCTGGGGCACGCCGTCAAGACGAGCCGGGCAGCGGCGTGGACGGCGGCGGGCATGTTTCTGGCTGTCTGGCTGCCGCTGGACAACGGCCTTCGGCCCGAGCCGATCATCGCCCTGGGCATCCTGCTGACCTGGTGCTCGGTGGAGCGGGCGGTGGCCACCAGCCGGCTGCTGCCGGTGGCAATCGCCTGCATCATCGGTGCCTTGACCCTGTTCTCCGGGCCGACGGGCATCGCCTCGATCGGTGCGCTGCTGGTCGCGATCGGGCCGCTACGGACCATCCTGCACCGGCGTTCCAGGCGGTTCGGCGTGCTACCACTGGTGGCGCCGATCCTGGCCGCGGCCACCGTCACCGCGATCCCGATCTTTCGTGATCAGACCTTCGCGGGCGAGATCCAGGCCAACCTCCTCAAGCGTGCCGTAGGGCCCAGCCTGAAGTGGTTCGACGAACACATCCGCTACGAGCGGCTGTTCATGGCCAGCCCCGACGGCTCGATCGCCCGCCGCTTCGCCGTGCTGGCCTTGGTGCTGGCGCTCGCGGTATCGGTGGCAATGTCGTTACGTAAGGGCCGCATTCCAGGTACCGCTGCTGGACCGAGCCGCCGCATCATCGGCATCACGATCATTTCCTTCCTCGCGATGATGTTCACCCCGACAAAGTGGACCCATCACTTCGGGGTGTTCGCGGGGTTGGCCGGGTCGCTGGGGGCGCTTGCCGCGGTCGCGGTGACGGGCGCTGCGATGCGCTCGCGGCGGAACCGGACCGTGTTCGCCGCCGTGGTGGTCTTCGTGTTGGCCCTGTCGTTCGCCAGTGTCAACGGCTGGTGGTACGTGTCCAACTTCGGTGTGCCATGGTCGAACTCGTTTCCGAAGTGGCGATGGTCGCTTACCACCGCACTCCTCGAGCTGACGGTGCTGGTGCTGCTGCTAGCGGCATGGTTCCACTTCGTCGCCAACGGTGACGGGCGCCGAACAGCCAGGCCAACCCGGTTTAGGGCACGACTAGCCGGAATTGTCCAGTCCCCGTTGGCAATTGCCACGTGGTTGCTGGTGCTTTTCGAGGTGGTATCGCTGACCCAGGCGATGATTTCCCAGTACCCGGCGTGGTCGGTTGGCCGGTCTAACCTACAGGCTTTGGCCGGCAAGACCTGCGGGCTGGCCGAAGACGTGCTGGTGGAGCTGGATCCCAACGCAGGCATGCTGGCGCCGGTGACCGCGCCGTTGGCCGACGCCCTGGGAGCCGGCCTGTCTGAAGCCTTCACACCCAACGGCATTCCCGCCGACGTCACCGCCGACCCGGTGATGGAACGTCCAGGGGATCGCAGTTTCCTCAACGACGACGGGCTGATCACCGGCAGCGAACCCGGCACCGAAGGGGGCACCACGGCCGCACCGGGAATCAACGGCTCCCGCGCCCGGCTGCCCTACAACCTGGACCCGGCCCGTACACCGGTGCTGGGCAGCTGGCGAGCCGGCGTGCAGGTGCCCGCCATGCTGCGGTCGGGCTGGTACCGGCTGCCCACCAACGAGCAGCGGGACAGGGCGCCGCTGCTGGTGGTGACGGCGGCCGGGCGATTCGACTCCCGCGAGGTCCGGTTGCAGTGGGCCACCGACGAGCAAGCGGCCGCCGGACACCACGGTGGGTCGATGGAATTCGCCGACGTCGGTGCCGCGCCGGCCTGGCGCAACCTGCGCGCACCACTGTCCGCCATCCCGAGCACCGCCACCCAGGTCCGGTTGGTCGCCGACGACCAGGATCTGGCGCCGCAGCACTGGATCGCCCTCACACCACCGCGGATTCCGCGGGTGCGCACGCTGCAGAACGTGGTGGGCGCAGCGGATCCGGTGTTCCTGGACTGGCTGGTGGGGCTGGCATTCCCCTGCCAACGCCCGTTCGGCCACCAATACGGCGTCGACGAGACACCCAAGTGGCGGATCCTGCCGGACCGGTTCGGCGCCGAAGCCAACTCACCGGTGATGGATCACAATGGCGGTGGCCCGCTGGGCATCACCGAGCTGCTGATGCGCGCAACCACGGTGGCCAGCTACCTCAAAGACGACTGGTTTAGGGACTGGGGCGCGTTACAGCGGTTGACGCCTTACTACCCCGACGCCCAGCCCGCTGATCTGAACCTAGGAACGGTGACTCGCAGCGGGCTGTGGAGTCCGGCGCCGTTGCGCCGCGGCTAG >>MEG_2713|Drugs|Mycobacterium_tuberculosis-specific_Drug|Ethambutol_resistant_arabinosyltransferase|EMBR|RequiresSNPConfirmation ATGGCTGGTAGCGCGACAGTGGAGAAGCGGCTCGACTTCGGCCTGCTTGGACCATTGCAGATGACTATCGACGGCACCCCGGTGCCATCGGGCACCCCCAAGCAACGGGCTGTGCTAGCCATGTTGGTCATCAACCGCAACAGGCCCGTAGGAGTCGACGCCCTAATCACCGCCCTCTGGGAGGAGTGGCCACCCTCGGGCGCACGCGCGAGTATCCACTCCTACGTGTCTAATCTGCGTAAGCTCCTCGGTGGCGCCGGGATCGACCCACGGGTGGTGTTGGCCGCAGCGCCGCCGGGTTATCGGCTCAGCATCCCCGACAACACTTGCGATCTGGGGCGGTTTGTTGCCGAAAAAACCGCGGGCGTGCACGCGGCCGCCGCCGGCCGGTTCGAACAAGCCAGCCGCCACCTGTCGGCCGCATTGAGAGAATGGCGTGGGCCGGTGCTCGATGACCTGCGCGACTTCCAGTTCGTCGAACCCTTTGCCACGGCGCTGGTAGAAGACAAGGTTCTTGCCCATACCGCCAAGGCGGAGGCCGAAATCGCGTGTGGGCGGGCCAGCGCAGTGATCGCCGAGCTCGAGGCTCTGACATTCGAACACCCCTACCGGGAGCCGCTGTGGACACAGCTGATCACCGCCTACTACCTCTCCGACCGGCAATCCGATGCGCTGGGCGCCTATCGCCGGGTGAAGACAACACTGGCCGACGACCTCGGCATCGACCCCGGTCCGACGTTGCGCGCTCTCAACGAGCGGATTCTGCGTCAGCAACCGCTGGATGCCAAGAAGTCCGCCAAAACCACCGCTGCCGGCACCGTCACGGTGCTCGATCAGCGCACCATGGCGTCGGGCCAGCAGGCGGTGGCCTACCTGCACGACATCGCCTCGGGTCGCGGCTACCCACTGCAAGCCGCGGCGACCCGGATCGGGCGTCTGCATGACAACGACATCGTCCTAGACAGCGCCAACGTCAGCCGCCACCACGCCGTCATCGTCGACACGGGCACCAACTACGTCATCAACGACCTCCGATCGTCCAACGGCGTGCATGTGCAGCACGAGCGAATCCGCTCCGCGGTCACGCTGAACGACGGCGACCACATTCGCATCTGTGACCATGAATTCACGTTCCAGATCAGCGCGGGGACGCATGGCGGCACGTAG >>MEG_2866|Drugs|Mycobacterium_tuberculosis-specific_Drug|Ethionamide-resistant_mutant|ETHA|RequiresSNPConfirmation ATGACCGAGCACCTCGACGTTGTCATCGTGGGCGCTGGAATCTCCGGTGTCAGCGCGGCCTGGCACCTGCAGGACCGTTGCCCGACCAAGAGCTACGCCATCCTGGAAAAGCGGGAATCCATGGGCGGCACCTGGGATTTGTTCCGTTATCCCGGAATTCGCTCCGACTCCGACATGTACACGCTAGGTTTCCGATTCCGTCCCTGGACCGGACGGCAGGCGATCGCCGACGGCAAGCCCATCCTCGAGTACGTCAAGAGCACCGCGGCCATGTATGGAATCGACAGGCATATCCGGTTCCACCACAAGGTGATCAGTGCCGATTGGTCGACCGCGGAAAACCGCTGGACCGTTCACATCCAAAGCCACGGCACGCTCAGCGCCCTCACCTGCGAATTCCTCTTTCTGTGCAGCGGCTACTACAACTACGACGAGGGCTACTCGCCGAGATTCGCCGGCTCGGAGGATTTCGTCGGGCCGATCATCCATCCGCAGCACTGGCCCGAGGACCTCGACTACGACGCTAAGAACATCGTCGTGATCGGCAGTGGCGCAACGGCGGTCACGCTCGTGCCGGCGCTGGCGGACTCGGGCGCCAAGCACGTCACGATGCTGCAGCGCTCACCCACCTACATCGTGTCGCAGCCAGACCGGGACGGCATCGCCGAGAAGCTCAACCGCTGGCTGCCGGAGACCATGGCCTACACCGCGGTACGGTGGAAGAACGTGCTGCGCCAGGCGGCCGTGTACAGCGCCTGCCAGAAGTGGCCACGGCGCATGCGGAAGATGTTCCTGAGCCTGATCCAGCGCCAGCTACCCGAGGGGTACGACGTGCGAAAGCACTTCGGCCCGCACTACAACCCCTGGGACCAGCGATTGTGCTTGGTGCCCAACGGCGACCTGTTCCGGGCCATTCGTCACGGGAAGGTCGAGGTGGTGACCGACACCATTGAACGGTTCACCGCGACCGGAATCCGGCTGAACTCAGGTCGCGAACTGCCGGCTGACATCATCATTACCGCAACGGGGTTGAACCTGCAGCTTTTTGGTGGGGCGACGGCGACTATCGACGGACAACAAGTGGACATCACCACGACGATGGCCTACAAGGGCATGATGCTTTCCGGCATCCCCAACATGGCCTACACGGTTGGCTACACCAATGCCTCCTGGACGCTGAAGGCCGACCTGGTGTCGGAGTTTGTCTGTCGCTTGTTGAATTACATGGACGACAACGGTTTTGACACCGTGGTCGTCGAGCGACCGGGCTCAGATGTCGAAGAGCGGCCCTTCATGGAGTTCACCCCAGGTTACGTGCTGCGCTCGCTGGACGAGCTGCCCAAGCAGGGTTCGCGTACACCGTGGCGCCTGAATCAGAACTACCTACGTGACATCCGGCTCATCCGGCGCGGCAAGATCGACGACGAGGGTCTGCGGTTCGCCAAAAGGCCTGCCCCGGTGGGGGTTTAG >>MEG_2933|Drugs|Mycobacterium_tuberculosis-specific_Drug|Para-aminosalicylic_acid_resistant_mutant|FOLC|RequiresSNPConfirmation ATGAATTCGACGAATTCCGGCCCGCCTGACTCGGGATCGGCCACCGGCGTCGTGCCCACTCCGGACGAGATCGCGTCCCTGCTGCAGGTTGAGCATCTACTCGACCAACGCTGGCCGGAGACCCGCATCGATCCGAGCCTGACCCGGATCAGCGCGTTGATGGACCTGCTGGGCTCGCCCCAACGCAGCTATCCGTCGATCCATATCGCGGGCACCAACGGCAAGACCTCGGTGGCGCGCATGGTCGACGCGCTGGTCACCGCGCTGCACCGGCGCACCGGCCGAACCACCAGCCCACACCTGCAGTCACCGGTGGAACGCATTTCGATCGACGGCAAGCCGATCAGCCCGGCGCAGTATGTGGCGACCTACCGGGAGATCGAGCCGTTGGTGGCGCTGATCGACCAGCAGTCGCAGGCTTCTGCGGGTAAGGGTGGCCCGGCGATGAGCAAGTTCGAGGTGCTCACCGCGATGGCGTTCGCGGCCTTTGCGGACGCGCCCGTCGACGTGGCAGTGGTCGAGGTGGGCATGGGCGGACGTTGGGACGCCACCAACGTGATCAACGCACCGGTCGCCGTCATCACCCCGATCAGCATTGATCACGTCGACTATCTCGGTGCCGATATCGCCGGGATCGCCGGGGAGAAGGCGGGCATCATCACTCGGGCCCCCGACGGTTCGCCGGACACCGTCGCGGTCATCGGGCGTCAGGTCCCGAAGGTCATGGAGGTGCTGCTGGCCGAATCGGTGCGCGCCGACGCGTCGGTGGCCCGGGAGGATTCCGAATTCGCGGTGCTACGGCGACAGATCGCGGTCGGCGGTCAGGTACTGCAACTGCAGGGCCTCGGCGGGGTTTACTCCGACATCTACTTGCCGCTGCACGGTGAACACCAGGCGCACAACGCGGTGCTCGCCCTCGCTTCCGTCGAGGCCTTTTTCGGTGCCGGTGCGCAGCGTCAGCTCGACGGCGACGCCGTCCGGGCCGGCTTTGCCGCCGTCACCAGTCCCGGCCGGTTGGAGCGCATGCGCAGCGCACCCACGGTGTTCATCGACGCCGCGCACAATCCGGCCGGGGCGAGTGCTCTGGCACAAACGCTGGCGCATGAGTTCGACTTCCGATTTCTGGTCGGGGTGCTCAGCGTGCTGGGCGACAAGGACGTGGACGGCATCCTGGCCGCACTGGAGCCGGTGTTCGATTCCGTCGTCGTGACCCACAACGGGTCGCCGCGGGCGCTGGATGTCGAGGCCCTGGCGCTGGCGGCCGGCGAGCGGTTCGGACCCGACCGGGTGCGCACCGCCGAGAACCTGCGCGATGCTATCGACGTTGCCACCTCACTGGTCGACGACGCCGCCGCCGACCCGGATGTGGCCGGGGACGCATTCTCGAGAACCGGGATCGTCATCACCGGCTCGGTTGTCACCGCAGGGGCGGCTCGGACCTTGTTCGGTCGTGATCCGCAATGA >>MEG_3429|Drugs|Mycobacterium_tuberculosis-specific_Drug|Isoniazid-resistant_mutant|INHA|RequiresSNPConfirmation ATGACAGGACTGCTGGACGGCAAACGGATTCTGGTTAGCGGAATCATCACCGACTCGTCGATCGCGTTTCACATCGCACGGGTAGCCCAGGAGCAGGGCGCCCAGCTGGTGCTCACCGGGTTCGACCGGCTGCGGCTGATTCAGCGCATCACCGACCGGCTGCCGGCAAAGGCCCCGCTGCTCGAACTCGACGTGCAAAACGAGGAGCACCTGGCCAGCTTGGCCGGCCGGGTGACCGAGGCGATCGGGGCGGGCAACAAGCTCGACGGGGTGGTGCATTCGATTGGGTTCATGCCGCAGACCGGGATGGGCATCAACCCGTTCTTCGACGCGCCCTACGCGGATGTGTCCAAGGGCATCCACATCTCGGCGTATTCGTATGCTTCGATGGCCAAGGCGCTGCTGCCGATCATGAACCCCGGAGGTTCCATCGTCGGCATGGACTTCGACCCGAGCCGGGCGATGCCGGCCTACAACTGGATGACGGTCGCCAAGAGCGCGTTGGAGTCGGTCAACAGGTTCGTGGCGCGCGAGGCCGGCAAGTACGGTGTGCGTTCGAATCTCGTTGCCGCAGGCCCTATCCGGACGCTGGCGATGAGTGCGATCGTCGGCGGTGCGCTCGGCGAGGAGGCCGGCGCCCAGATCCAGCTGCTCGAGGAGGGCTGGGATCAGCGCGCTCCGATCGGCTGGAACATGAAGGATGCGACGCCGGTCGCCAAGACGGTGTGCGCGCTGCTGTCTGACTGGCTGCCGGCGACCACGGGTGACATCATCTACGCCGACGGCGGCGCGCACACCCAATTGCTCTAG >>MEG_3430|Drugs|Mycobacterium_tuberculosis-specific_Drug|Ethambutol-resistant_mutant|INIA|RequiresSNPConfirmation ATGGTCCCCGCCGGTTTGTGCGCATACCGTGATCTGAGGCGTAAACGAGCGAGAAAGTGGGGCGACACGGTGACCCAGCCCGATGACCCACGTCGGGTCGGTGTGATCGTCGAACTGATCGATCACACTATCGCCATCGCCAAACTGAACGAGCGTGGTGATCTAGTACAGCGGTTGACGCGGGCTCGCCAGCGGATCACCGACCCGCAGGTCCGTGTGGTGATCGCCGGGCTGCTCAAACAGGGCAAGAGTCAATTGCTCAATTCGTTGCTCAACCTGCCCGCGGCGCGAGTAGGCGATGACGAGGCCACCGTGGTGATCACCGTCGTAAGCTACAGCGCCCAACCGTCGGCCCGGCTTGTGCTGGCCGCCGGGCCCGACGGGACAACCGCAGCGGTTGACATTCCCGTCGATGACATCAGCACCGATGTGCGTCGGGCTCCGCACGCCGGTGGCCGCGAGGTGTTGCGGGTCGAGGTCGGCGCGCCCAGCCCGCTGCTGCGGGGCGGGCTGGCGTTTATCGATACTCCGGGTGTGGGCGGCCTCGGACAGCCCCACCTGTCGGCGACGCTGGGGCTGCTACCCGAGGCCGATGCCGTCTTGGTGGTCAGCGACACCAGCCAGGAATTCACCGAACCCGAGATGTGGTTCGTGCGGCAGGCCCACCAGATCTGTCCGGTCGGGGCGGTCGTGGCCACCAAGACCGACCTGTATCCGCGCTGGCGGGAGATCGTCAATGCCAATGCAGCACATCTGCAGCGGGCCCGGGTTCCGATGCCGATCATCGCAGTCTCATCACTGTTGCGCAGCCACGCGGTCACGCTTAACGACAAAGAGCTCAACGAAGAGTCCAACTTTCCGGCGATCGTCAAGTTTCTCAGCGAGCAGGTGCTTTCCCGCGCGACGGAGCGAGTGCGTGCTGGGGTACTCGGCGAAATACGTTCGGCAACAGAGCAATTGGCGGTGTCTCTAGGTTCCGAACTATCGGTGGTCAACGACCCGAACCTCCGTGACCGACTTGCTTCGGATTTGGAGCGGCGCAAACGGGAAGCCCAGCAGGCGGTGCAACAGACAGCGCTGTGGCAGCAGGTGCTGGGCGACGGGTTCAACGACCTGACTGCTGACGTGGACCACGACCTACGAACCCGCTTCCGCACCGTCACCGAAGACGCCGAGCGCCAGATCGACTCCTGTGACCCGACTGCGCATTGGGCCGAGATTGGCAACGACGTCGAGAATGCGATCGCCACAGCGGTCGGCGACAACTTCGTGTGGGCATACCAGCGTTCCGAAGCGTTGGCCGACGACGTCGCTCGCTCCTTTGCCGACGCGGGGTTGGACTCGGTCCTGTCAGCAGAGCTGAGCCCCCACGTCATGGGCACCGACTTCGGCCGGCTCAAAGCGCTGGGCCGGATGGAATCGAAACCGCTGCGCCGGGGCCATAAAATGATTATCGGCATGCGGGGTTCCTATGGCGGCGTGGTCATGATTGGCATGCTGTCGTCGGTGGTCGGACTTGGGTTGTTCAACCCGCTATCGGTGGGGGCCGGGTTGATCCTCGGCCGGATGGCATATAAAGAGGACAAACAAAACCGGTTGCTGCGGGTGCGCAGCGAGGCCAAGGCCAATGTGCGGCGCTTCGTCGACGACATTTCGTTCGTCGTCAGCAAACAATCACGGGATCGGCTCAAGATGATCCAGCGTCTGCTGCGCGACCACTACCGCGAGATCGCCGAAGAGATCACCCGGTCGCTCACCGAGTCCCTGCAGGCGACCATCGCGGCGGCGCAGGTGGCGGAAACCGAGCGGGACAATCGAATTCGGGAACTTCAGCGGCAATTGGGTATCCTGAGCCAGGTCAACGACAACCTTGCCGGCTTGGAGCCAACCTTGACGCCCCGGGCGAGCTTGGGACGAGCGTGA >>MEG_3431|Drugs|Mycobacterium_tuberculosis-specific_Drug|Ethambutol-resistant_mutant|INIB|RequiresSNPConfirmation ATGACCTCGCTTATCGATTACATCCTGAGCCTGTTCCGCAGCGAAGACGCCGCCCGGTCGTTCGTTGCCGCTCCGGGACGGGCCATGACCAGTGCCGGGCTGATCGATATCGCGCCGCACCAAATCTCATCGGTGGCGGCCAATGTGGTGCCGGGTCTGAATCTGGGTGCCGGCGACCCCATGAGCGGATTGCGGCAGGCCGTCGCCGCTCGGCATGGCTTTGCGCAGGACGTCGCCAATGTCGGCTTCGCCGGTGACGCGGGCGCGGGGGTGGCAAGCGTCATCACGACCGATGTCGGTGCGGGCCTGGCTAGCGGACTGGGTGCTGGGTTCCTGGGTCAGGGTGGCCTGGCTCTCGCCGCGTCAAGCGGTGGTTTCGGCGGTCAGGTCGGCTTGGCTGCCCAGGTCGGTCTGGGTTTTACTGCCGTGATTGAGGCCGAGGTCGGCGCTCAGGTTGGTGCTGGGTTAGGTATTGGGACGGGTCTGGGTGCTCAGGCCGGTATGGGCTTTGGCGGCGGGGTTGGCCTGGGTCTGGGTGGTCAGGCCGGCGGTGTGATCGGTGGGAGCGCGGCCGGGGCTATCGGTGCCGGCGTCGGCGGTCGCCTAGGCGGCAATGGCCAGATCGGAGTTGCCGGCCAGGGTGCCGTTGGCGCTGGTGTCGGCGCTGGTGTCGGCGGCCAGGCGGGCATCGCTAGCCAGATCGGTGTCTCAGCCGGTGGTGGGCTCGGCGGCGTCGGCAATGTCAGCGGCCTGACCGGGGTCAGCAGCAACGCAGTGTTGGCTTCCAACGCAAGCGGCCAGGCGGGGTTGATCGCCAGTGAAGGCGCTGCCTTGAACGGCGCTGCTATGCCTCATCTGTCGGGCCCGTTAGCCGGTGTCGGTGTGGGTGGTCAGGCCGGCGCCGCTGGCGGCGCCGGGTTGGGCTTCGGAGCGGTCGGGCACCCGACTCCTCAGCCGGCGGCCCTGGGCGCGGCTGGCGTGGTGGCCAAGACCGAGGCGGCTGCTGGAGTGGTTGGCGGGGTCGGCGGGGCAACCGCGGCCGGGGTCGGCGGGGCACACGGCGACATCCTGGGCCACGAGGGAGCCGCACTGGGCAGTGTCGACACGGTCAACGCCGGTGTCACGCCCGTCGAGCATGGCTTGGTCCTGCCCAGTGGCCCCCTGATCCACGGCGGTACCGGCGGCTATGGCGGCATGAACCCGCCAGTGACCGATGCGCCGGCACCGCAAGTTCCGGCGCGGGCCCAGCCGATGACCACGGCGGCCGAGCACACGCCGGCGGTTACCCAACCGCAGCACACGCCGGTCGAGCCGCCGGTCCACGATAAGCCGCCGAGCCATTCGGTGTTTGACGTCGGTCACGAGCCGCCGGTGACGCACACGCCGCCGGCGCCCATCGAACTGCCGTCGTACGGCCTTTTCGGACTACCCGGGTTCTGA >>MEG_3432|Drugs|Mycobacterium_tuberculosis-specific_Drug|Ethambutol-resistant_mutant|INIC|RequiresSNPConfirmation GTGAGCACCAGCGACCGGGTCCGCGCGATTCTGCACGCAACCATCCAGGCCTACCGGGGTGCGCCGGCCTATCGTCAGCGTGGCGACGTTTTTTGCCAGCTGGACCGCATCGGTGCGCGCCTAGCCGAACCGCTGCGCATCGCGTTGGCTGGCACACTCAAGGCCGGAAAATCCACTCTCGTCAACGCCCTTGTCGGCGACGACATCGCTCCGACCGATGCCACCGAGGCCACCCGGATTGTGACCTGGTTCCGGCACGGTCCGACACCGCGGGTCACCGCCAACCATCGCGGCGGTCGACGCGCCAACGTGCCGATCACCCGTCGGGGCGGGCTGAGTTTCGACCTGCGCAGGATCAACCCGGCCGAGCTGATCGACCTGGAAGTCGAGTGGCCAGCCGAGGAACTCATCGACGCCACCATTGTTGACACCCCGGGAACGTCGTCGTTGGCATGCGATGCCTCCGAGCGCACGTTGCGGCTGCTGGTCCCCGCCGACGGGGTGCCTCGGGTGGATGCGGTGGTGTTCCTGTTGCGCACCCTGAACGCCGCTGACGTCGCGCTGCTCAAACAGATCGGTGGGCTGGTCGGCGGGTCGGTGGGAGCCCTGGGCATCATCGGGGTGGCGTCTCGCGCGGATGAGATCGGCGCGGGCCGCATCGACGCGATGCTCTCGGCCAACGACGTGGCCAAGCGGTTCACCCGCGAACTGAACCAGATGGGCATTTGCCAGGCGGTGGTGCCGGTATCCGGACTTCTTGCGCTGACCGCGCGCACACTGCGCCAGACCGAGTTCATCGCGCTGCGCAAGCTGGCCGGTGCCGAGCGCACCGAGCTCAATAGGGCCCTGCTGAGCGTGGACCGTTTTGTGCGCCGGGACAGTCCGCTACCGGTGGACGCGGGCATCCGTGCGCAATTGCTCGAGCGGTTCGGCATGTTCGGCATCCGGATGTCGATTGCCGTGCTGGCGGCCGGCGTGACCGATTCGACCGGGCTGGCCGCCGAACTGCTGGAGCGCAGCGGGCTGGTGGCGCTGCGCAATGTGATAGACCAGCAGTTCGCGCAGCGCTCCGACATGCTTAAGGCGCATACCGCCTTGGTCTCCTTGCGCCGATTCGTGCAGACGCATCCGGTGCCGGCGACCCCGTACGTCATTGCCGACATCGACCCGTTGCTAGCCGACACCCACGCCTTCGAAGAACTCCGAATGCTAAGCCTTTTGCCTTCGCGGGCAACGACATTGAACGACGACGAAATCGCGTCGCTGCGCCGCATCATCGGCGGGTCGGGCACCAGTGCCGCCGCTCGGCTGGGCCTGGATCCCGCGAATTCTCGCGAGGCCCCGCGCGCCGCGCTGGCCGCAGCGCAACACTGGCGTCGCCGTGCGGCGCATCCACTCAACGATCCGTTCACTACCAGGGCCTGTCGCGCGGCGGTGCGCAGCGCCGAGGCGATGGTGGCGGAGTTCTCTGCTCGCCGCTGA >>MEG_3445|Drugs|Mycobacterium_tuberculosis-specific_Drug|Isoniazid-resistant_mutant|KASA|RequiresSNPConfirmation GTGAGTCAGCCTTCCACCGCTAATGGCGGTTTCCCCAGCGTTGTGGTGACCGCCGTCACAGCGACGACGTCGATCTCGCCGGACATCGAGAGCACGTGGAAGGGTCTGTTGGCCGGCGAGAGCGGCATCCACGCACTCGAAGACGAGTTCGTCACCAAGTGGGATCTAGCGGTCAAGATCGGCGGTCACCTCAAGGATCCGGTCGACAGCCACATGGGCCGACTCGACATGCGACGCATGTCGTACGTCCAGCGGATGGGCAAGTTGCTGGGCGGACAGCTATGGGAGTCCGCCGGCAGCCCGGAGGTCGATCCAGACCGGTTCGCCGTTGTTGTCGGCACCGGTCTAGGTGGAGCCGAGAGGATTGTCGAGAGCTACGACCTGATGAATGCGGGCGGCCCCCGGAAGGTGTCCCCGCTGGCCGTTCAGATGATCATGCCCAACGGTGCCGCGGCGGTGATCGGTCTGCAGCTTGGGGCCCGCGCCGGGGTGATGACCCCGGTGTCGGCCTGTTCGTCGGGCTCGGAAGCGATCGCCCACGCGTGGCGTCAGATCGTGATGGGCGACGCCGACGTCGCCGTCTGCGGCGGTGTCGAAGGACCCATCGAGGCGCTGCCCATCGCGGCGTTCTCCATGATGCGGGCCATGTCGACCCGCAACGACGAGCCTGAGCGGGCCTCCCGGCCGTTCGACAAGGACCGCGACGGCTTTGTGTTCGGCGAGGCCGGTGCGCTGATGCTCATCGAGACGGAGGAGCACGCCAAAGCCCGTGGCGCCAAGCCGTTGGCCCGATTGCTGGGTGCCGGTATCACCTCGGACGCCTTTCATATGGTGGCGCCCGCGGCCGATGGTGTTCGTGCCGGTAGGGCGATGACTCGCTCGCTGGAGCTGGCCGGGTTGTCGCCGGCGGACATCGACCACGTCAACGCGCACGGCACGGCGACGCCTATCGGCGACGCCGCGGAGGCCAACGCCATCCGCGTCGCCGGTTGTGATCAGGCCGCGGTGTACGCGCCGAAGTCTGCGCTGGGCCACTCGATCGGCGCGGTCGGTGCGCTCGAGTCGGTGCTCACGGTGCTGACGCTGCGCGACGGCGTCATCCCGCCGACCCTGAACTACGAGACACCCGATCCCGAGATCGACCTTGACGTCGTCGCCGGCGAACCGCGCTATGGCGATTACCGCTACGCAGTCAACAACTCGTTCGGGTTCGGCGGCCACAATGTGGCGCTTGCCTTCGGGCGTTACTGA >>MEG_3446|Drugs|Mycobacterium_tuberculosis-specific_Drug|Isoniazid-resistant_mutant|KATG|RequiresSNPConfirmation GTGCCCGAGCAACACCCACCCATTACAGAAACCACCACCGGAGCCGCTAGCAACGGCTGTCCCGTCGTGGGTCATATGAAATACCCCGTCGAGGGCGGCGGAAACCAGGACTGGTGGCCCAACCGGCTCAATCTGAAGGTACTGCACCAAAACCCGGCCGTCGCTGACCCGATGGGTGCGGCGTTCGACTATGCCGCGGAGGTCGCGACCATCGACGTTGACGCCCTGACGCGGGACATCGAGGAAGTGATGACCACCTCGCAGCCGTGGTGGCCCGCCGACTACGGCCACTACGGGCCGCTGTTTATCCGGATGGCGTGGCACGCTGCCGGCACCTACCGCATCCACGACGGCCGCGGCGGCGCCGGGGGCGGCATGCAGCGGTTCGCGCCGCTTAACAGCTGGCCCGACAACGCCAGCTTGGACAAGGCGCGCCGGCTGCTGTGGCCGGTCAAGAAGAAGTACGGCAAGAAGCTCTCATGGGCGGACCTGATTGTTTTCGCCGGCAACTGCGCGCTGGAATCGATGGGCTTCAAGACGTTCGGGTTCGGCTTCGGCCGGGTCGACCAGTGGGAGCCCGATGAGGTCTATTGGGGCAAGGAAGCCACCTGGCTCGGCGATGAGCGTTACAGCGGTAAGCGGGATCTGGAGAACCCGCTGGCCGCGGTGCAGATGGGGCTGATCTACGTGAACCCGGAGGGGCCGAACGGCAACCCGGACCCCATGGCCGCGGCGGTCGACATTCGCGAGACGTTTCGGCGCATGGCCATGAACGACGTCGAAACAGCGGCGCTGATCGTCGGCGGTCACACTTTCGGTAAGACCCATGGCGCCGGCCCGGCCGATCTGGTCGGCCCCGAACCCGAGGCTGCTCCGCTGGAGCAGATGGGCTTGGGCTGGAAGAGCTCGTATGGCACCGGAACCGGTAAGGACGCGATCACCAGCGGCATCGAGGTCGTATGGACGAACACCCCGACGAAATGGGACAACAGTTTCCTCGAGATCCTGTACGGCTACGAGTGGGAGCTGACGAAGAGCCCTGCTGGCGCTTGGCAATACACCGCCAAGGACGGCGCCGGTGCCGGCACCATCCCGGACCCGTTCGGCGGGCCAGGGCGCTCCCCGACGATGCTGGCCACTGACCTCTCGCTGCGGGTGGATCCGATCTATGAGCGGATCACGCGTCGCTGGCTGGAACACCCCGAGGAATTGGCCGACGAGTTCGCCAAGGCCTGGTACAAGCTGATCCACCGAGACATGGGTCCCGTTGCGAGATACCTTGGGCCGCTGGTCCCCAAGCAGACCCTGCTGTGGCAGGATCCGGTCCCTGCGGTCAGCCACGACCTCGTCGGCGAAGCCGAGATTGCCAGCCTTAAGAGCCAGATCCGGGCATCGGGATTGACTGTCTCACAGCTAGTTTCGACCGCATGGGCGGCGGCGTCGTCGTTCCGTGGTAGCGACAAGCGCGGCGGCGCCAACGGTGGTCGCATCCGCCTGCAGCCACAAGTCGGGTGGGAGGTCAACGACCCCGACGGGGATCTGCGCAAGGTCATTCGCACCCTGGAAGAGATCCAGGAGTCATTCAACTCCGCGGCGCCGGGGAACATCAAAGTGTCCTTCGCCGACCTCGTCGTGCTCGGTGGCTGTGCCGCCATAGAGAAAGCAGCAAAGGCGGCTGGCCACAACATCACGGTGCCCTTCACCCCGGGCCGCACGGATGCGTCGCAGGAACAAACCGACGTGGAATCCTTTGCCGTGCTGGAGCCCAAGGCAGATGGCTTCCGAAACTACCTCGGAAAGGGCAACCCGTTGCCGGCCGAGTACATGCTGCTCGACAAGGCGAACCTGCTTACGCTCAGTGCCCCTGAGATGACGGTGCTGGTAGGTGGCCTGCGCGTCCTCGGCGCAAACTACAAGCGCTTACCGCTGGGCGTGTTCACCGAGGCCTCCGAGTCACTGACCAACGACTTCTTCGTGAACCTGCTCGACATGGGTATCACCTGGGAGCCCTCGCCAGCAGATGACGGGACCTACCAGGGCAAGGATGGCAGTGGCAAGGTGAAGTGGACCGGCAGCCGCGTGGACCTGGTCTTCGGGTCCAACTCGGAGTTGCGGGCGCTTGTCGAGGTCTATGGCGCCGATGACGCGCAGCCGAAGTTCGTGCAGGACTTCGTCGCTGCCTGGGACAAGGTGATGAACCTCGACAGGTTCGACGTGCGCTGA >>MEG_4130|Drugs|Mycobacterium_tuberculosis-specific_Drug|Isoniazid-resistant_mutant|NDH|RequiresSNPConfirmation ATGAGTCCCCAGCAAGAACCCACAGCGCAACCACCTCGTAGGCATCGAGTTGTGATCATCGGATCTGGGTTCGGCGGGCTAAACGCGGCAAAGAAGCTCAAGCGGGCCGACGTTGACATCAAGCTGATCGCGCGCACCACCCATCACCTGTTCCAGCCGCTGCTGTACCAAGTGGCCACCGGGATTATCTCCGAGGGAGAAATCGCTCCGCCGACCCGGGTCGTGCTGCGTAAGCAGCGCAATGTCCAGGTACTGTTGGGCAACGTCACCCACATCGACCTGGCCGGGCAGTGCGTCGTCTCGGAATTGCTCGGTCACACCTACCAAACCCCCTACGACAGCCTGATCGTCGCCGCGGGTGCTGGCCAGTCTTATTTCGGCAACGACCATTTCGCCGAATTCGCACCCGGCATGAAGTCCATCGACGACGCGTTGGAGTTGCGTGGCCGCATATTGAGCGCTTTCGAGCAAGCCGAACGGTCCAGCGATCCGGAACGGCGGGCCAAGCTACTGACATTCACCGTTGTCGGGGCTGGCCCCACCGGTGTTGAAATGGCCGGACAGATCGCCGAGCTGGCCGAGCACACGTTGAAGGGCGCATTCCGGCACATCGACTCGACCAAGGCGCGGGTGATTCTGCTTGACGCCGCCCCGGCGGTGCTGCCACCGATGGGCGCAAAGCTCGGTCAGCGGGCGGCTGCCCGGTTGCAGAAGCTGGGCGTGGAAATCCAGCTGGGTGCGATGGTCACCGACGTCGACCGCAACGGCATCACCGTCAAGGACTCCGACGGCACCGTCCGGCGCATCGAGTCGGCCTGCAAGGTCTGGTCGGCCGGGGTTTCGGCCAGTCGGTTGGGCAGGGACCTTGCCGAGCAATCACGGGTTGAGCTCGACCGGGCCGGCCGGGTCCAAGTGCTGCCCGACCTGTCCATTCCCGGGTACCCGAACGTGTTCGTGGTGGGCGATATGGCCGCTGTGGAGGGTGTGCCGGGTGTGGCGCAGGGCGCCATCCAGGGGGCGAAATACGTCGCCAGCACGATCAAGGCCGAACTGGCCGGCGCCAACCCGGCGGAGCGTGAGCCATTCCAGTACTTCGACAAGGGATCGATGGCCACGGTTTCGAGGTTTTCGGCGGTGGCCAAGATCGGTCCCGTTGAGTTCAGCGGCTTTATCGCCTGGCTGATTTGGCTGGTGCTGCACCTGGCGTACCTGATCGGGTTCAAGACCAAGATCACCACTCTGCTGTCGTGGACGGTGACTTTCCTCAGTACTCGCCGCGGCCAGCTGACCATCACCGACCAGCAGGCATTTGCGCGAACGCGGCTCGAACAGCTGGCCGAGCTGGCCGCCGAGGCGCAGGGCTCAGCGGCAAGCGCTAAGGTGGCCAGCTAG >>MEG_4131|Drugs|Mycobacterium_tuberculosis-specific_Drug|Isoniazid-resistant_mutant|NDH|RequiresSNPConfirmation ATGAGTCCCCAGCAAGAACCCACAGCGCAACCACCTCGTAGGCATCGAGTTGTGATCATCGGATCTGGGTTCGGCGGGCTAAACGCGGCAAAGAAGCTCAAGCGGGCCGACGTTGACATCAAGCTGATCGCGCGCACCACCCATCACCTGTTCCAGCCGCTGCTGTACCAAGTGGCCACCGGGATTATCTCCGAGGGAGAAATCGCTCCGCCGACCCGGGTCGTGCTGCGTAAGCAGCGCAATGTCCAGGTACTGTTGGGCAACGTCACCCACATCGACCTGGCCGGGCAGTGCGTCGTCTCGGAATTGCTCGGTCACACCTACCAAACCCCCTACGACAGCCTGATCGTCGCCGCGGGTGCTGGCCAGTCTTATTTCGGCAACGACCATTTCGCCGAATTCGCACCCGGCATGAAGTCCATCGACGACGCGTTGGAGTTGCGTGGCCGCATATTGAGCGCTTTCGAGCAAGCCGAACGGTCCAGCGATCCGGAACGGCGGGCCAAGCTACTGACATTCACCGTTGTCGGGGCTGGCCCCACCGGTGTTGAAATGGCCGGACAGATCGCCGAGCTGGCCGAGCACACGTTGAAGGGCGCATTCCGGCACATCGACTCGACCAAGGCGCGGGTGATTCTGCTTGACGCCGCCCCGGCGGTGCTGCCACCGATGGGCGCAAAGCTCGGTCAGCGGGCGGCTGCCCGGTTGCAGAAGCTGGGCGTGGAAATCCAGCTGGGTGCGATGGTCACCGACGTCGACCGCAACGGCATCACCGTCAAGGACTCCGACGGCACCGTCCGGCGCATCGAGTCGGCCTGCAAGGTCTGGTCGGCCGGGGTTTCGGCCAGTCGGTTGGGCAGGGACCTTGCCGAGCAATCACGGGTTGAGCTCGACCGGGCCGGCCGGGTCCAAGTGCTGCCCGACCTGTCCATTCCCCGGTACCCGAACGTGTTCGTGGTGGGCGATATGGCCGCTGTGGAGGGTGTGCCGGGTGTGGCGCAGGGCGCCATCCAGGGGGCGAAATACGTCGCCAGCACGATCAAGGCCGAACTGGCCGGCGCCAACCCGGCGGAGCGTGAGCCATTCCAGTACTTCGACAAGGGATCGATGGCCACGGTTTCGAGGTTTTCGGCGGTGGCCAAGATCGGTCCCGTTGAGTTCAGCGGCTTTATCGCCTGGCTGATTTGGCTGGTGCTGCACCTGGCGTACCTGATCGGGTTCAAGACCAAGATCACCACTCTGCTGTCGTGGACGGTGACTTTCCTCAGTACTCGCCGCGGCCAGCTGACCATCACCGACCAGCAGGCATTTGCGCGAACGCGGCTCGAACAGCTGGCCGAGCTGGCCGCCGAGGCGCAGGGCTCAGCGGCAAGCGCTAAGGTGGCCAGCTAG >>MEG_4132|Drugs|Mycobacterium_tuberculosis-specific_Drug|Isoniazid-resistant_mutant|NDH|RequiresSNPConfirmation ATGAGCCATCCCGGAGCTACGGCGTCGGATCGGCATAAAGTCGTCATCATCGGTTCGGGTTTCGGTGGTCTCACCGCTGCCAAGACCCTCAAGCGCGCTGACGTCGACGTCAAGCTAATCGCCCGTACCACGCACCACCTCTTCCAGCCGCTGCTCTACCAGGTGGCGACCGGCATCATCTCCGAGGGCGAGATCGCCCCGGCCACTCGAGTGATCCTCCGCAAGCAGAAGAACGCCCAGGTCCTTCTCTGCGATGTGACGCACATCGATCTGGAGAACAAGACCGTGGATTCGGTGCTGCTCGGTCACACCTACTCGACGCCCTACGACAGCCTCATCATCGCCGCGGGCGCGGGTCAGTCCTACTTCGGCAACGACCACTTCGCCGAGTTCGCACCCGGCATGAAGTCGATCGACGATGCGCTGGAGCTGCGCGGTCGCATCCTCGGCGCGTTCGAACAGGCCGAGCGCTCCAGCGACCCGGTGCGCCGCGCGAAGTTGCTGACGTTCACCGTCGTCGGCGCGGGCCCGACCGGCGTCGAGATGGCCGGACAGATCGCCGAATTGGCCGACCAGACTTTGCGGGGCAGCTTCCGCCACATCGATCCCACCGAGGCCCGGGTGATCCTGCTCGACGCCGCACCGGCCGTGCTACCGCCCATGGGCGAGAAGCTCGGCAAGAAGGCGCGGGCCCGTCTGGAGAAGATGGGCGTCGAGGTCCAGCTGGGTGCGATGGTCACCGACGTCGACCGCAACGGCATCACCGTCAAGGATTCCGACGGGACCATCCGTCGCATCGAGTCGGCGTGCAAGGTGTGGTCGGCCGGTGTGTCGGCCAGCCCTCTCGGCAAGGATCTCGCCGAGCAGTCGGGTGTCGAACTCGACCGCGCGGGCCGGGTCAAGGTACAGCCCGACCTGACGCTGCCCGGTCACCCGAACGTGTTCGTCGTGGGCGACATGGCGGCCGTCGAGGGCGTGCCCGGTGTGGCGCAGGGCGCCATCCAGGGTGGCCGCTACGCCGCGAAGATCATCAAGCGTGAGGTCAGTGGCACCAGCCCGAAGATCCGCACGCCGTTCGAGTACTTCGACAAGGGCTCGATGGCGACGGTGTCGCGGTTCTCCGCGGTGGCCAAGGTGGGTCCCGTCGAGTTCGCGGGCTTCTTCGCCTGGTTGTGCTGGCTCGTGCTGCACCTGGTGTACCTGGTCGGGTTCAAGACGAAGATCGTCACACTGCTGTCGTGGGGCGTGACGTTCCTGAGCACCAAGCGTGGTCAGCTCACCATCACCGAGCAGCAGGCCTATGCGCGAACCCGCATCGAGGAGCTCGAGGAGATCGCGGCGGCGGTGCAGGACACCGAGAAAGCCGCGTCCTAG >>MEG_5803|Drugs|Mycobacterium_tuberculosis-specific_Drug|Pyrazinamide-resistant_mutant|PNCA|RequiresSNPConfirmation ATGCGGGCGTTGATCATCGTCGACGTGCAGAACGACTTCTGCGAGGGTGGCTCGCTGGCGGTAACCGGTGGCGCCGCGCTGGCCCGCGCCATCAGCGACTACCTGGCCGAAGCGGCGGACTACCATCACGTCGTGGCAACCAAGGACTTCCACATCGACCCGGGTGACCACTTCTCCGGCACACCGGACTATTCCTCGTCGTGGCCACCGCATTGCGTCAGCGGTACTCCCGGCGCGGACTTCCATCCCAGTCTGGACACGTCGGCAATCGAGGCGGTGTTCTACAAGGGTGCCTACACCGGAGCGTACAGCGGCTTCGAAGGAGTCGACGAGAACGGCACGCCACTGCTGAATTGGCTGCGGCAACGCGGCGTCGATGAGGTCGATGTGGTCGGTATTGCCACCGATCATTGTGTGCGCCAGACGGCCGAGGACGCGGTACGCAATGGCTTGGCCACCAGGGTGCTGGTGGACCTGACAGCGGGTGTGTCGGCCGATACCACCGTCGCCGCGCTGGAGGAGATGCGCACCGCCAGCGTCGAGTTGGTTTGCAGCTCCTGA >>MEG_6055|Drugs|Mycobacterium_tuberculosis-specific_Drug|Para-aminosalicylic_acid_resistant_mutant|RIBD|RequiresSNPConfirmation ATGCCCGACTCTGGTCAGCTCGGAGCCGCTGACACCCCGCTAAGGCTGCTCAGCTCGGTGCATTACCTCACCGACGGCGAACTCCCCCAGCTTTACGACTATCCGGATGACGGCACCTGGTTGCGGGCGAACTTCATCAGCAGCTTGGACGGCGGCGCTACCGTCGATGGCACCAGCGGGGCGATGGCCGGGCCCGGCGACCGATTCGTCTTCAACCTGTTGCGTGAACTTGCCGACGTCATCGTGGTCGGCGTGGGCACCGTGCGCATTGAGGGCTACTCCGGCGTCCGGATGGGTGTCGTCCAGCGCCAGCACCGGCAGGCCCGAGGCCAAAGCGAAGTTCCGCAACTGGCAATCGTCACCAGGTCCGGTCGCCTTGACCGTGACATGGCGGTATTCACCCGGACCGAGATGGCACCGTTGGTGCTCACCACCACGGCGGTCGCCGATGACACGCGCCAGCGGCTCGCGGGCCTCGCCGAGGTGATCGCGTGCTCCGGCGACGATCCGGGCACGGTCGATGAGGCAGTGCTCGTGTCCCAGCTCGCGGCTCGCGGTCTGCGCCGGATCCTTACCGAAGGCGGGCCGACGTTGCTCGGGACATTCGTCGAGCGTGACGTGCTCGACGAGCTGTGTCTGACGATCGCCCCCTACGTCGTCGGCGGCCTGGCGCGCCGCATAGTGACGGGACCCGGGCAGGTGCTGACCCGGATGCGCTGTGCCCATGTCCTCACCGACGACTCCGGCTACCTGTACACCCGCTACGTCAAGACCTGA >>MEG_6142|Drugs|Mycobacterium_tuberculosis-specific_Drug|Pyrazinamide-resistant_mutant|RPSA|RequiresSNPConfirmation ATGCCGAGTCCCACCGTCACCTCGCCGCAAGTAGCCGTCAACGACATAGGCTCTAGCGAGGACTTTCTCGCCGCAATAGACAAAACGATCAAGTACTTCAACGATGGCGACATCGTCGAAGGCACCATCGTCAAAGTGGACCGGGACGAGGTGCTCCTCGACATCGGCTACAAGACCGAAGGCGTGATCCCCGCCCGCGAACTGTCCATCAAGCACGACGTCGACCCCAACGAGGTCGTTTCCGTCGGTGACGAGGTCGAAGCCCTGGTGCTCACCAAGGAGGACAAAGAGGGCCGGCTCATCCTCTCCAAGAAACGCGCGCAGTACGAGCGTGCCTGGGGCACCATCGAGGCGCTCAAGGAGAAGGACGAGGCCGTCAAGGGCACGGTCATCGAGGTCGTCAAGGGTGGCCTGATCCTCGACATCGGGCTGCGCGGTTTCCTGCCCGCCTCGCTGGTGGAGATGCGCCGGGTGCGCGACCTGCAGCCCTACATCGGCAAGGAGATCGAGGCCAAGATCATCGAGCTGGACAAGAACCGCAACAACGTGGTGCTGTCCCGTCGCGCCTGGCTGGAGCAGACCCAGTCCGAGGTGCGCAGCGAGTTCCTGAATAACTTGCAAAAAGGCACCATCCGAAAGGGTGTCGTGTCCTCGATCGTCAACTTCGGCGCGTTCGTCGATCTCGGCGGTGTGGACGGTCTGGTGCATGTCTCCGAGCTATCGTGGAAGCACATCGACCACCCGTCCGAGGTGGTCCAGGTTGGTGACGAGGTCACCGTCGAGGTGCTCGACGTCGACATGGACCGTGAGCGGGTTTCGTTGTCACTCAAGGCGACTCAGGAAGACCCGTGGCGGCACTTCGCCCGCACTCACGCGATCGGGCAGATCGTGCCGGGCAAGGTCACCAAGTTGGTTCCGTTCGGTGCATTCGTCCGCGTCGAGGAGGGTATCGAGGGCCTGGTGCACATCTCCGAGCTGGCCGAGCGTCACGTCGAGGTGCCCGATCAGGTGGTTGCCGTCGGCGACGACGCGATGGTCAAGGTCATCGACATCGACCTGGAGCGCCGTCGGATCTCGTTGTCGCTCAAGCAAGCCAATGAGGACTACACCGAGGAGTTCGACCCGGCGAAGTACGGCATGGCCGACAGTTACGACGAGCAGGGCAACTACATCTTCCCCGAGGGCTTCGATGCCGAAACCAACGAATGGCTTGAGGGATTCGAAAAGCAGCGCGCCGAATGGGAAGCTCGGTACGCCGAGGCCGAGCGCCGGCACAAGATGCACACCGCGCAGATGGAGAAGTTCGCCGCCGCCGAGGCGGCTGGACGCGGCGCGGACGATCAGTCGTCGGCCAGTAGCGCACCGTCGGAAAAGACCGCGGGTGGATCACTGGCCAGCGACGCCCAGCTGGCGGCCCTGCGGGAAAAACTCGCCGGCAGCGCTTGA >>MEG_7250|Drugs|Mycobacterium_tuberculosis-specific_Drug|Para-aminosalicylic_acid_resistant_mutant|THYA|RequiresSNPConfirmation GTGACGCCATACGAGGACCTGCTGCGCTTCGTGCTCGAAACGGGTACGCCCAAATCCGACCGCACCGGCACCGGAACCCGCAGCCTGTTCGGCCAGCAGATGCGCTATGATTTGTCGGCCGGTTTCCCGCTGCTCACTACCAAGAAAGTCCATTTCAAATCGGTAGCCTACGAGCTGCTGTGGTTTTTGCGCGGCGATTCCAATATCGGTTGGCTGCACGAGCACGGAGTCACCATCTGGGACGAATGGGCAAGTGATACAGGCGAACTCGGGCCGATCTACGGTGTACAATGGCGATCGTGGCCGGCTCCATCCGGTGAGCACATCGACCAGATCAGCGCGGCGCTGGATTTGCTGCGCACCGATCCCGATTCCCGGCGCATCATCGTGTCGGCCTGGAACGTCGGCGAAATCGAGCGGATGGCGCTGCCGCCCTGTCATGCGTTCTTCCAGTTCTACGTCGCCGATGGCCGGCTGAGCTGTCAGCTCTACCAACGCAGCGCCGACCTGTTTCTGGGTGTGCCGTTCAACATCGCCAGCTATGCGTTGCTCACCCACATGATGGCCGCCCAGGCCGGCTTGTCGGTCGGCGAGTTCATCTGGACCGGTGGCGACTGCCACATCTACGACAATCACGTCGAGCAAGTACGGCTGCAGCTCAGCCGCGAGCCGCGGCCATATCCGAAACTACTTCTAGCCGACCGGGATTCAATCTTCGAGTACACCTATGAAGACATCGTTGTGAAGAACTACGATCCGCATCCGGCGATCAAAGCTCCAGTCGCGGTATGA >>MEG_7804|Drugs|Mycobacterium_tuberculosis-specific_Drug|Viomycin_phosphotransferases|VPH ATGAGAATCATTGAGACGCACCGCGATCTGCTGAGCCGGCTCCTGCCCGGGGACACCGTGGGCGGACTCGCCGTCCACGAGGGGCAGTTCCACCATGTGGTGATCGGATCGCACCGGGTGGTCTGCTTCGCCCGCACCCGGGCGGCCGCCGACCGTCTGCCCGGCAGGGCGGACGTCCTGCGCGCTCTTGCCGGGATCGACCTCGGGTTTCGCACGCCGCAGCCGCTGTCCGAGGGCGGCGCCCAGGGCACGGACGAGCCGCCGTACCTGGTGCTGAGCCGCATTCCCGGAGCACCGTTGGAGGACGATGTGCTCACCAGCCCGGAGGTGGCGGAGGCCGTCGCCCGACAGTACGCGACCCTGCTGTCCGGGCTCGCGGCGGCGGGCGACGAGGAGAAGGTGCGCGCCGCGCTGCCGGAGGCTCCCGCGAACGAGTGGCAGGAGTTCGCCACGGGGGTGCGTACCGAACTGTTCCCGCTGATGTCCGACGGCGGCCGGGAGCGTGCCGAGCGCGAGCTCGCCGCGCTCGACGCCCTGCCCCATCTCACCTCCGCGGTGGTCCACGGTGACCTCGGCGGCGAGAACGTCCTGTGGGAGACGGTGGACGGAGTGCCGCGCATGAGCGGCGTCGTCGACTGGGACGAGGTCGGCATCGGCGACCCGGCTGAGGACCTGGCCGCCATCGGGGCGAGCTACGGCGAGGAACTGCTGGGCCGAGTGCTCGCGCTCGGCGGCTGGGCCGACAACGGAACGGCCGAGCGGATCTCGGCGATCCGAGGCACCTTCGCACTCCAGCAGGCCCTCTACGCGCAGCGCGACGGCGACGAGGAGGAACTCGCCGACGGCCTCAGCGGCTACCGGTAG