Warning: "continue" targeting switch is equivalent to "break". Did you mean to use "continue 2"? in /home/meglabuser/megares.meglab.org/vendor/doctrine/orm/lib/Doctrine/ORM/UnitOfWork.php on line 2640
MEGARes
MEGAResFrom MEG, the Microbial Ecology Group

Notice: Trying to access array offset on value of type null in /home/meglabuser/megares.meglab.org/vendor/doctrine/annotations/lib/Doctrine/Common/Annotations/DocParser.php on line 967

PNCA

The pncA gene encodes a pyrazinamidase that converts pyrazinamide to its active form in Mycobacterium tuberculosis. Specific mutations in pncA can result in loss of typical function and therefore resistance to pyrazinamide.

References

  • http://www.ncbi.nlm.nih.gov/pmc/articles/PMC89721/

Deprecated: The behavior of unparenthesized expressions containing both '.' and '+'/'-' will change in PHP 8: '+'/'-' will take a higher precedence in /home/meglabuser/megares.meglab.org/src/Sequence.php on line 169

Notice: Trying to access array offset on value of type null in /home/meglabuser/megares.meglab.org/vendor/doctrine/annotations/lib/Doctrine/Common/Annotations/DocParser.php on line 967

Other Groups in Pyrazinamide-resistant mutant

Sequences

Download Sequences

>>MEG_5803|Drugs|Mycobacterium_tuberculosis-specific_Drug|Pyrazinamide-resistant_mutant|PNCA|RequiresSNPConfirmation
ATGCGGGCGTTGATCATCGTCGACGTGCAGAACGACTTCTGCGAGGGTGGCTCGCTGGCGGTAACCGGTGGCGCCGCGCT
GGCCCGCGCCATCAGCGACTACCTGGCCGAAGCGGCGGACTACCATCACGTCGTGGCAACCAAGGACTTCCACATCGACC
CGGGTGACCACTTCTCCGGCACACCGGACTATTCCTCGTCGTGGCCACCGCATTGCGTCAGCGGTACTCCCGGCGCGGAC
TTCCATCCCAGTCTGGACACGTCGGCAATCGAGGCGGTGTTCTACAAGGGTGCCTACACCGGAGCGTACAGCGGCTTCGA
AGGAGTCGACGAGAACGGCACGCCACTGCTGAATTGGCTGCGGCAACGCGGCGTCGATGAGGTCGATGTGGTCGGTATTG
CCACCGATCATTGTGTGCGCCAGACGGCCGAGGACGCGGTACGCAATGGCTTGGCCACCAGGGTGCTGGTGGACCTGACA
GCGGGTGTGTCGGCCGATACCACCGTCGCCGCGCTGGAGGAGATGCGCACCGCCAGCGTCGAGTTGGTTTGCAGCTCCTG
A