MEGAResFrom MEG, the Microbial Ecology Group

Notice: Trying to access array offset on value of type null in /home/meglabuser/megares.meglab.org/vendor/doctrine/annotations/lib/Doctrine/Common/Annotations/DocParser.php on line 967

THYA

The THYA group of genes confer resistance to Mycobacterium tuberculosis-specific Drug through the mechanism, Para-aminosalicylic acid resistant mutation.

References


    Notice: Trying to access array offset on value of type null in /home/meglabuser/megares.meglab.org/vendor/doctrine/annotations/lib/Doctrine/Common/Annotations/DocParser.php on line 967

    Other Groups in Para-aminosalicylic acid resistant mutant

    Sequences

    Download Sequences

    >>MEG_7250|Drugs|Mycobacterium_tuberculosis-specific_Drug|Para-aminosalicylic_acid_resistant_mutant|THYA|RequiresSNPConfirmation
    GTGACGCCATACGAGGACCTGCTGCGCTTCGTGCTCGAAACGGGTACGCCCAAATCCGACCGCACCGGCACCGGAACCCG
    CAGCCTGTTCGGCCAGCAGATGCGCTATGATTTGTCGGCCGGTTTCCCGCTGCTCACTACCAAGAAAGTCCATTTCAAAT
    CGGTAGCCTACGAGCTGCTGTGGTTTTTGCGCGGCGATTCCAATATCGGTTGGCTGCACGAGCACGGAGTCACCATCTGG
    GACGAATGGGCAAGTGATACAGGCGAACTCGGGCCGATCTACGGTGTACAATGGCGATCGTGGCCGGCTCCATCCGGTGA
    GCACATCGACCAGATCAGCGCGGCGCTGGATTTGCTGCGCACCGATCCCGATTCCCGGCGCATCATCGTGTCGGCCTGGA
    ACGTCGGCGAAATCGAGCGGATGGCGCTGCCGCCCTGTCATGCGTTCTTCCAGTTCTACGTCGCCGATGGCCGGCTGAGC
    TGTCAGCTCTACCAACGCAGCGCCGACCTGTTTCTGGGTGTGCCGTTCAACATCGCCAGCTATGCGTTGCTCACCCACAT
    GATGGCCGCCCAGGCCGGCTTGTCGGTCGGCGAGTTCATCTGGACCGGTGGCGACTGCCACATCTACGACAATCACGTCG
    AGCAAGTACGGCTGCAGCTCAGCCGCGAGCCGCGGCCATATCCGAAACTACTTCTAGCCGACCGGGATTCAATCTTCGAG
    TACACCTATGAAGACATCGTTGTGAAGAACTACGATCCGCATCCGGCGATCAAAGCTCCAGTCGCGGTATGA