MEGAResFrom MEG, the Microbial Ecology Group

Notice: Trying to access array offset on value of type null in /home/meglabuser/megares.meglab.org/vendor/doctrine/annotations/lib/Doctrine/Common/Annotations/DocParser.php on line 967

NFXB

The nfxB gene encodes a LacI/GalR family regulator of the MexCD multi-drug efflux system.

References

  • http://www.sciencedirect.com/science/article/pii/S0006291X14009711

Notice: Trying to access array offset on value of type null in /home/meglabuser/megares.meglab.org/vendor/doctrine/annotations/lib/Doctrine/Common/Annotations/DocParser.php on line 967

Other Groups in Multi-drug RND efflux pumps

Sequences

Download Sequences

>>MEG_4161|Drugs|Multi-drug_resistance|Multi-drug_RND_efflux_pumps|NFXB|RequiresSNPConfirmation
ATGACCCTGATTTCCCATGACGAGCGACTCATCAAGGCGCTGGCAGTCGCTATCGTCGACCGCCCGCGAGCGACGCTGAA
GGAACTGGCCGAGGCGGCCGGCGTAAGCAAGGCCACCCTGCACCGCTTCTGCGGCACGCGGGACAACCTGGTGCAGATGC
TCGAGGACCACGGAGAGACCGTACTGAACCAGATCATCCAGGCCTGCGACCTGGAGCATGCCGAGCCTCTGGAGGCGTTG
CAGCGCCTGATCAAGGAACACCTCACCCACCGCGAGCTGCTGGTATTCCTGGTATTCCAGTACCGCCCGGACTTCCTCGA
CCCGCACGGCGAAGGCGCACGCTGGCAGTCCTACCTGGAAGCGCTGGACGCCTTCTTCCTGCGCGGACAGCAGAAAGGCG
TGTTTCGCATCGACATCACGGCGGCCGTGTTCACCGAACTGTTCATCACCCTGGTCTACGGCATGGTCGATGCGGAACGT
CGCGGACGGGCGGCCAGCTCCAATTCCGCGCATACCCTGGAGCAGATGTTCCTCCATGGCGCCTCCAATCCGGCTCGCTC
CTGA