MEGAResFrom MEG, the Microbial Ecology Group

Notice: Trying to access array offset on value of type null in /home/meglabuser/megares.meglab.org/vendor/doctrine/annotations/lib/Doctrine/Common/Annotations/DocParser.php on line 967

HNS

The H-NS protein is a histone-like protein that participates in global gene regulation. It has been implicated in the expression of several multi-drug efflux systems, including acrEF, mdtEF, and emrKY.

References

  • http://www.ncbi.nlm.nih.gov/pubmed/14973023

Notice: Trying to access array offset on value of type null in /home/meglabuser/megares.meglab.org/vendor/doctrine/annotations/lib/Doctrine/Common/Annotations/DocParser.php on line 967

Other Groups in Multi-drug RND efflux pumps

Sequences

Download Sequences

>>MEG_3271|Drugs|Multi-drug_resistance|Multi-drug_RND_efflux_pumps|HNS
ATGAGCGAAGCACTTAAAATTCTGAACAACATCCGTACTCTTCGTGCGCAGGCAAGAGAATGTACACTTGAAACGCTGGA
AGAAATGCTGGAAAAATTAGAAGTTGTTGTTAACGAACGTCGCGAAGAAGAAAGCGCGGCTGCTGCTGAAGTTGAAGAGC
GCACTCGTAAACTGCAGCAATATCGCGAAATGCTGATCGCTGACGGTATTGACCCGAACGAGCTGCTGAATAGCCTTGCC
GCCGTTAAATCTGGCACCAAAGCTAAACGTGCTCAGCGTCCGGCAAAATATAGCTACGTTGACGAAAACGGCGAAACTAA
AACCTGGACTGGCCAGGGCCGTACTCCAGCTGTAATCAAAAAAGCAATGGATGAGCAAGGTAAATCCCTCGACGATTTCC
TGATCAAGCAATAA