Warning: "continue" targeting switch is equivalent to "break". Did you mean to use "continue 2"? in /home/meglabuser/megares.meglab.org/vendor/doctrine/orm/lib/Doctrine/ORM/UnitOfWork.php on line 2640
MEGARes
MEGAResFrom MEG, the Microbial Ecology Group

Notice: Trying to access array offset on value of type null in /home/meglabuser/megares.meglab.org/vendor/doctrine/annotations/lib/Doctrine/Common/Annotations/DocParser.php on line 967

ROSA

The rosA/B genes encode an efflux system that acts on cationic antimicrobial peptides and other drugs.

References

  • http://www.ncbi.nlm.nih.gov/pubmed/10931306

Deprecated: The behavior of unparenthesized expressions containing both '.' and '+'/'-' will change in PHP 8: '+'/'-' will take a higher precedence in /home/meglabuser/megares.meglab.org/src/Sequence.php on line 169

Notice: Trying to access array offset on value of type null in /home/meglabuser/megares.meglab.org/vendor/doctrine/annotations/lib/Doctrine/Common/Annotations/DocParser.php on line 967

Other Groups in Multi-drug MFS efflux pumps

Sequences

Download Sequences

>>MEG_6083|Drugs|Multi-drug_resistance|Multi-drug_MFS_efflux_pumps|ROSA
ATGACCGATCGTTCTGAGACGGAGCTCCCTCCCTCCGTCAATACCCAGCCCTTCGATAATACCAAGGTAAAACGCACCTC
TTTCTCTATATTAGGTGCTATTAGCGTATCTCACTTACTTAACGATATGATCCAGTCGCTGATTCTGGCGATTTATCCGC
TATTACAAGCCGAGTTTTCGCTGAGTTTTGCGCAGATTGGATTAATCACCCTCACTTATCAGCTTACCGCCTCATTATTA
CAGCCACTTATTGGTCTTTATACCGATAAGCATCCGCAGCCCTATTCACTGCCGATTGGCATGGGTTTCACCTTATCAGG
TATCTTGCTGCTTGCGGTTGCCACGACTTTCCCAGGTGGTTTTACATGGCATGCGGCATTAGTCGGAACCGGTTCTTCGG
TCTTCCACCCAGAATCCTCACGCGTAGCCGCTAGGCTACCGGTGGCCGCCACGGTATGGCTCAGTCTATTTTTGGGTGGG
AGGCAATTTCGGCAGCGCCTTGGCCCACTATTAGCCGCGATCCTTATCGCACCTTACGGTAAAGGCAATGTAGGTTGGTT
TTCACTCGCGGCACTGCTGGCTATTGTGGTGCTGTTGCAGGTCAGTAAATGGTATCAGCAACAACAAAGAGCAACCTATG
GCAAAGTAGTAAAAGTCTCATCGGCCAAAATACTGCCTAAAAAGACGGTTATTAGCGCCCTAGCTATCTTAATGGTGCTG
ATATTCTCTAAATACTTCTACTTGACCAGTATTAGTAGCTATTACACCTTTTATTTGATGCATAAGTTTGGTGTTTCGGT
ACAAAATGCCCAAATACATTTATTTGTCTTCTTATTCGCAGTGGCCGCTGGCACCATCATTGGCGGCCCTCTTGGCGATA
GGATAGGTCGAAAGTATGTTATTTGGGGGTCAATATTGGGCGTTGCGCCATTTACCCTTATTTTACCCTACGTTTCTCTG
TATTGGACCGGGGTTTTAACCGTGATCATTGGCCTTATCCTTGCCTCTGCCTTCTCGGCAATACTGGTGTATGCGCAAGA
GCTTATTCCGGGTAAAGTGGGCATGGTATCCGGTCTATTCTTCGGTTTTGCTTTCGGTATGGGGGGGTTAGGTGCGGCTG
TACTAGGGTATGTTGCTGATTTAACCAGTATTGAACTGGTTTATCAAATATGCGCCTTCTTACCATTACTGGGGATAATT
ACGGTCTTCCTGCCCAATATAGAAGATAAGTAA