MEGAResFrom MEG, the Microbial Ecology Group

Notice: Trying to access array offset on value of type null in /home/meglabuser/megares.meglab.org/vendor/doctrine/annotations/lib/Doctrine/Common/Annotations/DocParser.php on line 967

CFRC

The CFRC group of genes confer resistance to Multi-drug resistance through the mechanism, MDR 23S ribosomal RNA methyltransferase.

References


    Notice: Trying to access array offset on value of type null in /home/meglabuser/megares.meglab.org/vendor/doctrine/annotations/lib/Doctrine/Common/Annotations/DocParser.php on line 967

    Other Groups in MDR 23S ribosomal RNA methyltransferase

    Sequences

    Download Sequences

    >>MEG_1685|Drugs|Multi-drug_resistance|MDR_23S_ribosomal_RNA_methyltransferase|CFRC
    ATGAAACAGACAAAAACGAAATATGGAAAAATGAAACAAATAGCATCGAATTTAAAATTACCTGATTATAGATACGAACA
    GCTTACAAAAGCTATTTTTCATCAAAGAATAGATAATTTTCATGATATGCATATACTACCAAAAGCGTTAAGGATAGCTT
    TAGTAAATGAGTTTGGAAAGAATGTATCTAGTGTAACACCTATTTTTTCACAAGATTCTAAACAAGCTCAAAAGTTGTTA
    TTTGAATTGACTGATGGAGAAAGAATAGAAGCCGTTGGACTAAAGTATAAACAGGGGTGGGAATCGTTTTGTATTTCTTC
    CCAATGTGGTTGTAGTTTTGGATGTCGTTTTTGTGCAACGGGAAGTGCTGGATTTAAACGCAATCTTACTGCTGATGAGA
    TAACTGACCAATTACTTTATTTCTATTTTAATGACCATAGATTGAATAGTATTTCATTTATGGGAATGGGTGAGGCTTTT
    GCAAATCCAGAGTTATTTGATGCAGTAAAAATTTTAACTGATCAAAATTTATTTGGGTTAAGTCAACGAAGAATTACTAT
    TTCAACAATTGGCATTATACCAGGAATTCAAAGACTGACTAAAGAATTTCCACAAGTGAATCTGGCTTTTTCACTTCATT
    CACCATTTGAAAGTCAACGAAGCGATTTAATGCCTATAAATAAAAGATTTCCATTGAATGAGGTAATGAAGACATTAGAT
    GAACATATCATTCATACGGGACGACGAGTGTTTATTGCTTATATTATGCTTGAAGGAATTAATGATTCGAAAGAACATGC
    AGAGGCAATTATAGGTTTATTGAGAAATCGTGGTTCATGGGAGCATTTATATCACATTGATTTGATACCTTATAATTCTA
    CGGACAAAACAACTTTTAAATTTCAATCTTCAAGTGCTATCAAGCAATTTTGCAGTACACTAAAGAAAGCTAGTATTAGT
    GCAACTGTTAGAACACAATTTGGTTCTGAAATTAGTGCTGCTTGCGGACAATTGTGTTATGAAAATGAATTATGA