Warning: "continue" targeting switch is equivalent to "break". Did you mean to use "continue 2"? in /home/meglabuser/megares.meglab.org/vendor/doctrine/orm/lib/Doctrine/ORM/UnitOfWork.php on line 2640
MEGARes
MEGAResFrom MEG, the Microbial Ecology Group

Notice: Trying to access array offset on value of type null in /home/meglabuser/megares.meglab.org/vendor/doctrine/annotations/lib/Doctrine/Common/Annotations/DocParser.php on line 967

OPRJ

The opm and opr genes are outer membrane proteins that often appear in conjunction with efflux pumps.

References

  • http://www.ncbi.nlm.nih.gov/pubmed/12885104

Deprecated: The behavior of unparenthesized expressions containing both '.' and '+'/'-' will change in PHP 8: '+'/'-' will take a higher precedence in /home/meglabuser/megares.meglab.org/src/Sequence.php on line 169

Notice: Trying to access array offset on value of type null in /home/meglabuser/megares.meglab.org/vendor/doctrine/annotations/lib/Doctrine/Common/Annotations/DocParser.php on line 967

Other Groups in Multi-biocide RND efflux pump

Sequences

Download Sequences

>>MEG_4297|Biocides|Multi-biocide_resistance|Multi-biocide_RND_efflux_pump|OPRJ
ATGCGCAAACCTGCTTTCGGCGTATCGGCGCTGCTGATCGCCCTGACCCTCGGCGCCTGCTCCATGGCGCCGACCTACGA
ACGTCCCGCCGCGCCGGTGGCCGACAGCTGGAGCGGCGCCGCCGCCCAGCGCCAGGGCGCGGCGATCGACACGCTGGATT
GGAAGAGTTTCATCGTCGATGCCGAACTACGCCGCCTGGTGGACATGGCCCTGGATAACATCCGCTCGCTGCGCCAGACC
CTCCTGGATATCGAGGCGGCCCGCGCGCAGTACCGAATCCAGCGCGCCGACCGGGTTCCGGGCCTGAATGCCGCTGCCAC
CGGCAACCGCCAGCGGCAGCCGGCCGACCTGTCCGCCGGCAATCGCTCGGAAGTGGCCAGCAGCTACCAGGTCGGGCTGG
CCCTGCCGGAGTACGAACTGGACCTCTTCGGTCGGGTCAAGAGCCTGACCGACGCAGCCCTGCAACAGTACCTGGCCAGC
GAGGAGGCAGCGCGCGCGGCACGGATCGCCCTGGTCGCCGAGGTCAGCCAGGCCTACCTGAGCTACGACGGCGCCCTGCG
GCGCCTGGCGCTGACCCGTCAGACCCTGGTCAGCCGCGAGTATTCCTTCGCCCTGATCGACCAGCGCCGCGCGGCCGGCG
CCGCCACCGCGCTGGACTACCAGGAAGCCCTTGGCCTGGTGGAGCAGGCGCGCGCCGAGCAGGAGCGCAACCTGCGGCAG
AAACAGCAGGCATTCAACGCGCTGGTGTTGCTGCTGGGTAGCGACGATGCCGCGCAGGCGATTCCGCGGAGTCCGGGGCA
GCGGCCGAAGCTGCTGCAGGACATCGCTCCCGGCACGCCGTCCGAGCTGATCGAGCGACGTCCGGACATCCTTGCCGCCG
AACATCGTTTGCGGGCGCGCAACGCGGATATCGGCGCGGCGCGCGCGGCGTTCTTCCCGCGCATCAGCCTGACCGGCAGC
TTCGGCACCTCCAGCGCGGAAATGTCCGGCCTGTTCGATGGCGGCTCGCGCTCCTGTAGCTTCCTGCCGACGTTGACGCT
GCCGATCTTCGATGGCGGGCGCAACCGTGCCAACCTGAGCCTGGCCGAGGCGCGCAAGGATTCGGCGGTGGCCGCCTACG
AGGGGACCATCCAGACCGCTTTCCGCGAGGTCGCCGACGCCCTGGCGGCCAGCGATACCCTGCGTCGCGAAGAGAAGGCC
CTGCGCGCCCTGGCGAACAGCAGCAACGAAGCCCTGAAGCTGGCCAAGGCACGCTACGAGAGTGGCGTCGACAACCACCT
GCGCTACCTCGATGCGCAGCGCAGCAGCTTCCTCAACGAGATCGCCTTCATCGACGGCAGCACCCAGCGGCAGATCGCCC
TGGTCGACCTGTTCCGCGCGCTCGGCGGAGGCTGGGACGAGGGACGGAGCCTGGTGGTACATCGAGGCGGCAGGAGTTGA

>>MEG_4298|Biocides|Multi-biocide_resistance|Multi-biocide_RND_efflux_pump|OPRJ
ATGCGCAAACCTGCTTTCGGCGTATCGGCGCTGCTGATCGCCCTGACCCTCGGCGCCTGCTCCATGGCGCCGACCTACGA
ACGTCCCGCCGCGCCGGTGGCCGACAGCTGGAGCGGCGCCGCCGCCCAGCGCCAGGGCGCGGCGATCGACACGCTGGATT
GGAAGAGTTTCATCGTCGATGCCGAACTACGCCGCCTGGTGGACATGGCCCTGGATAACAACCGCTCGCTGCGCCAGACC
CTCCTGGATATCGAGGCGGCCCGCGCGCAGTACCGAATCCAGCGCGCCGACCGGGTTCCGGGCCTGAATGCCGCTGCCAC
CGGCAACCGCCAGCGGCAGCCGGCCGACCTGTCCGCCGGCAATCGCTCGGAAGTGGCCAGCAGCTACCAGGTCGGGCTGG
CCCTGCCGGAGTACGAACTGGACCTCTTCGGTCGGGTCAAGAGCCTGACCGACGCAGCCCTGCAACAGTACCTGGCCAGC
GAGGAGGCAGCGCGCGCGGCACGGATCGCCCTGGTCGCCGAGGTCAGCCAGGCCTACCTGAGCTACGACGGCGCCCTGCG
GCGCCTGGCGCTGACCCGTCAGACCCTGGTCAGCCGCGAGTATTCCTTCGCCCTGATCGACCAGCGCCGCGCGGCCGGCG
CCGCCACCGCGCTGGACTACCAGGAAGCCCTTGGCCTGGTGGAGCAGGCGCGCGCCGAGCAGGAGCGCAACCTGCGGCAG
AAACAGCAGGCATTCAACGCGCTGGTGTTGCTGCTGGGTAGCGACGATGCCGCGCAGGCGATTCCGCGGAGTCCGGGGCA
GCGGCCGAAGCTGCTGCAGGACATCGCTCCCGGCACGCCGTCCGAGCTGATCGAGCGACGTCCGGACATCCTTGCCGCCG
AACATCGTTTGCGGGCGCGCAACGCGGATATCGGCGCGGCGCGCGCGGCGTTCTTCCCGCGCATCAGCCTGACCGGCAGC
TTCGGCACCTCCAGCGCGGAAATGTCCGGCCTGTTCGATGGCGGCTCGCGCTCCTGGAGCTTCCTGCCGACGTTGACGCT
GCCGATCTTCGATGGCGGGCGCAACCGTGCCAACCTGAGCCTGGCCGAGGCGCGCAAGGATTCGGCGGTGGCCGCCTACG
AGGGGACCATCCAGACCGCTTTCCGCGAGGTCGCCGACGCCCTGGCGGCCAGCGATACCCTGCGTCGCGAAGAGAAGGCC
CTGCGCGCCCTGGCGAACAGCAGCAACGAAGCCCTGAAGCTGGCCAAGGCACGCTACGAGAGTGGCGTCGACAACCACCT
GCGCTACCTCGATGCGCAGCGCAGCAGCTTCCTCAACGAGATCGCCTTCATCGACGGCAGCACCCAGCGGCAGATCGCCC
TGGTCGACCTGTTCCGCGCGCTCGGCGGAGGCTGGGACGAGGGACGGAGCCTGGTGGTACATCGAGGCGGCAGGAGTTGA