Warning: "continue" targeting switch is equivalent to "break". Did you mean to use "continue 2"? in /home/meglabuser/megares.meglab.org/vendor/doctrine/orm/lib/Doctrine/ORM/UnitOfWork.php on line 2640
MEGARes
MEGAResFrom MEG, the Microbial Ecology Group

Notice: Trying to access array offset on value of type null in /home/meglabuser/megares.meglab.org/vendor/doctrine/annotations/lib/Doctrine/Common/Annotations/DocParser.php on line 967

NIME

The nim genes encode inducible nitroimidazole reductases, which modify metronidazole and cause resistance.

References

  • http://www.ncbi.nlm.nih.gov/pmc/articles/PMC549250/

Deprecated: The behavior of unparenthesized expressions containing both '.' and '+'/'-' will change in PHP 8: '+'/'-' will take a higher precedence in /home/meglabuser/megares.meglab.org/src/Sequence.php on line 169

Notice: Trying to access array offset on value of type null in /home/meglabuser/megares.meglab.org/vendor/doctrine/annotations/lib/Doctrine/Common/Annotations/DocParser.php on line 967

Other Groups in nim nitroimidazole reductase

Sequences

Download Sequences

>>MEG_4183|Drugs|Metronidazole|nim_nitroimidazole_reductase|NIME
atgttcagagaaatgcgtcgtaaacgacagttgttgccacaagaagagagcgtggcaattcttgaaaaaatgacaaacgg
gactttagctctccacggagataatggctatccttatgccgttcctctcagttatttttatgctgatggcaaaatctatt
ttcattgcgccaagatagggcataaggtggacgctattatgcaaaacaataaagtatcgttttgcgttgtggaacaagac
aatattaaacctgccgaattcacgacctactttcgaagtgtgatagtctttggaaaggcctatattttaaccgacgaaac
agaaaaacgtatggctatgactttgctggtgaataaatattctttcggtgagccaggtttgtctgatgaaatagccaaaa
gcatcaaccatctactgatggtaaagatcgatatcgaacacatgacgggcaaggaggccatcgatttggttagagagaaa
gaaaagttttgtacttcagagaaaacctcttga

>>MEG_4184|Drugs|Metronidazole|nim_nitroimidazole_reductase|NIME
ATGTTCAGAGAAATGCGTCGTAAACGACAGTTGTTGCCACAAGAAGAGAGCGTGGCAATTCTTGAAAAAATGACAAACGG
GACTTTAGCTCTCCACGGAGATAATGGCTATCCTTATGCCGTTCCTCTCAGTTATTTTTATGCTGATGGCAAAATCTATT
TTCATTGCGCCAAGATAGGGCATAAGGTGGACGCTATTATGCAAAACAATAAAGTATCGTTTTGCGTTGTGGAACAAGAC
AATATTAAACCTGCCGAATTCACGACCTACTTTCGAAGTGTGATAGTCTTTGGAAAGGCCTATATTTTAACCGACGAAAC
AGAAAAACGTATGGCTATGACTTTGCTGGTGAATAAATATTCTTTCGGTGAGCCAGGTTTGTCTGATGAAATAGCCAAAA
GCATCAACCATCTACTGATGGTAAAGATCGATATC

>>MEG_4185|Drugs|Metronidazole|nim_nitroimidazole_reductase|NIME
ATGTTCAGAGAAATGCGGCGTAAGCGACAGTTGTTGCCACAAGAAGAGAGCGTGGCAATTCTTGAAAAAATGACAAACGG
GACTTTAGCTCTCCACGGAGATAATGGCTATCCTTATGCCGTTCCTCTCAGTTATGTTTATGCTGATGGCAAAATCTATT
TTCATTGCGCCAAGATAGGGCATAAGGTGGACGCTATTATGCAAAACAATAAAGTATCGTTTTGCGTTGTGGAACAAGAC
AATATTAAACCTGCCGAATTCACGACCTACTTTCGAAGTGTGATAGTCTTTGGAAAGGCCTATATTTTAACCGACGAAAC
AGAAAAACGTATGGCTTTGACTTTGCTGATGAATAAATATTCTTTCGGTGAGCCAGGTTTGTCTGATGAAATAGCCAAAA
GCTTCAACCATCTACTGATGGTAAAGATCGATATCGAGCACATGACAGGCAAGGAAGC