Warning: "continue" targeting switch is equivalent to "break". Did you mean to use "continue 2"? in /home/meglabuser/megares.meglab.org/vendor/doctrine/orm/lib/Doctrine/ORM/UnitOfWork.php on line 2640

Deprecated: The behavior of unparenthesized expressions containing both '.' and '+'/'-' will change in PHP 8: '+'/'-' will take a higher precedence in /home/meglabuser/megares.meglab.org/src/Sequence.php on line 169

Warning: Cannot modify header information - headers already sent by (output started at /home/meglabuser/megares.meglab.org/vendor/doctrine/orm/lib/Doctrine/ORM/UnitOfWork.php:2640) in /home/meglabuser/megares.meglab.org/browse/download.php on line 41

Warning: Cannot modify header information - headers already sent by (output started at /home/meglabuser/megares.meglab.org/vendor/doctrine/orm/lib/Doctrine/ORM/UnitOfWork.php:2640) in /home/meglabuser/megares.meglab.org/browse/download.php on line 42

Warning: Cannot modify header information - headers already sent by (output started at /home/meglabuser/megares.meglab.org/vendor/doctrine/orm/lib/Doctrine/ORM/UnitOfWork.php:2640) in /home/meglabuser/megares.meglab.org/browse/download.php on line 43

Warning: Cannot modify header information - headers already sent by (output started at /home/meglabuser/megares.meglab.org/vendor/doctrine/orm/lib/Doctrine/ORM/UnitOfWork.php:2640) in /home/meglabuser/megares.meglab.org/browse/download.php on line 44

Warning: Cannot modify header information - headers already sent by (output started at /home/meglabuser/megares.meglab.org/vendor/doctrine/orm/lib/Doctrine/ORM/UnitOfWork.php:2640) in /home/meglabuser/megares.meglab.org/browse/download.php on line 45

Warning: Cannot modify header information - headers already sent by (output started at /home/meglabuser/megares.meglab.org/vendor/doctrine/orm/lib/Doctrine/ORM/UnitOfWork.php:2640) in /home/meglabuser/megares.meglab.org/browse/download.php on line 46
>>MEG_3837|Metals|Mercury_resistance|Mercury_resistance_protein|MERA atgaccaccctgaaaatcaccgggatgacctgcgactcgtgcgcggctcacgtcaaggaagccttggagaaagtgcccggcgtgcaatcggcgctggtgtcctatccgaagggcacagcgcaactcgccattgaggcgggcacgtcatcggatgcgctgactaccgccgtggccggactgggctacgaggcaacgcttgccgatgcgccaccgacggacaaccgcgccggcctgctcgacaagatgcgcggctggataggggccgctgataagcccagtggcaacgaacgcccgttgcaggtcgtcgtcattggtagcggtggcgcggcaatggcggcagcactgaaggccgtcgagcaaggcgcgcacgtctcgctgatcgagcgcggcaccatcggcggcacctgcgtcaacgtcggctgcgtgccgtccaagatcatgattcgcgccgcccacatcgcccatttacgtcgggaaagtccgttcgacggcggtatcgcggcgactgtgcctgcgattgaccgcagcaaactactggcccagcagcaggcgcgcgttcaaaaactgcgccatgccaagtacgaaggcattctggacggcaacccggccatcaccgttgtacatggtgaggcgcgtttcaaggatgagcagagcctggtcgtccgtttaaacgatggtggcgagcgcgtggtagctttcgaccgctgcttagtcgccacgggtgccagcccggccgtgccgccgattccgggcctgaaagagtcaccctactggacttcgaccgaggccctggtcagcgacacccttcccgaacgcctagccgtgatcggctcgtcggtggtcgcgctggaactggcgcaagccttcgcccggctgggcagccaggtcacgatcctagctcgcaacacgctgttcttccgcgacgacccgtccatcggcgaggccgtcacagcggccttccgtgccgaagggatcaaggtactggaacacacgcaagccagccaggtcgcgcatgtgaacggcgaattcgtgctgaccacgggacacggtgaagtacgtgccgacaagctgctggtcgctaccggacggacaccgaacacgcgcagcctggcactcgacgcggcgggagtcaccgtcaatgcgcagggtgccatcgtcatcgacaagggcatgcgcaccagcacgccacacatttacgcggccggcgactgcacggaccagccacaattcgtctatgtggcggcagcggccggcacccgtgccgcgatcaacatgaccggaggggatgctgccatcaatctaaccgcgatgccggccgtggtgttcaccgatccgcaagtagcaaccgtgggctacagcgaagcggaagcgcatcacgacgggatcgaaaccgacagtcgcacgctcacgctcgacaacgtgccgcgtgcgcttgccaacttcgacacacgcggctttatcaagctggtcatcgaggaaggtagcggacggctcatcggcgtgcaggtcgtcgccccggaagccggcgaattgatccagacggcngttctcgccattcgcaaccgcatgacggtgcaggaactggccgaccagttgttcccctacctgacgatggtcgaggggttgaagctcgcggcgcagaccttcagcaaggacgtgaagcagctttcgtgttgtgccggatga >>MEG_3838|Metals|Mercury_resistance|Mercury_resistance_protein|MERA ATGAAAAAATATCGAGTGAACGTGCAAGGAATGACATGTTCGGGTTGTGAACAGCATGTAGCTGTCGCTCTTGAAAACATGGGTGCAAAAGCGATTGAAGTAGATTTTCGCCGTGGAGAAGCTGTATTTGAGCTTCCTGATGACGTGAAAGTTGAAGACGCGAAAAATGCGATTGCTGACGCAAACTATCACCCGGGCGAAGCAGAAGAATTTCAATCGGAACAAAAGACGAATTTATTGAAAAAATATCGGCTAAACGTTGAAGGAATGACCTGCACTGGTTGTGAAGAACATATTGCGGTTGCTCTTGAAAATGCAGGTGCAAAAGGGATTGAAGTAGACTTTCGTCGCGGAGAAGCACTGTTTGAACTACCGTATGATGTAGACATTGATATCGCGAAAACAGCGATTACTGACGCACAATATCAACCGGGCGAAGCAGAAGAAATACAAGTGCAATCGGAAAAAAGGACAGATGTAAGTTTAAATGATGAAGGTAACTATGATTATGATTACATCATCATCGGTTCTGGTGGAGCTGCCTTTTCATCTGCCATTGAAGCCGTTGCTTTGAACGCAAAAGTGGCTATGATTGAGCGTGGAACGGTGGGTGGAACTTGCGTTAATGTCGGATGCGTTCCTTCTAAGACCTTATTAAGAGCAGGGGAAATCAATCATCTAGCAAAAAATAATCCATTTGTGGGATTACACACTTCGGCTTCAAATGTTGATTTAGCGCCATTAGTAAAACAAAAGAATGATTTAGTAACCGAGATGCGAAATGAAAAATATGTGAATTTAATTGATGATTATGGTTTTGAATTAATAAAAGGTGAATCAAAATTCGTAAATGAAAATACAGTTGAAGTAAATGGCAATCAAATCACAGCCAAAAGATTTTTAATAGCTACAGGTGCTTCTTCAACTGCACCTAATATTCCCGGATTAGATGAAGTAGATTATTTAACAAGCACTAGCTTATTGGAATTAAAGAAGGTTCCAAATCGTCTTACCGTAATTGGTTCAGGATATATCGGCATGGAATTAGGACAACTATTTCATAACCTCGGGTCAGAAGTCACTTTGATTCAAAGAAGCGAGCGTCTATTAAAAGAATACGATCCTGAAATTTCAGAAGCCATTACTAAGGCCTTAACAGAACAGGGAATTAATTTAGTAACAGGTGCAACCTATGAACGAGTTGAGCAAGATGGAGACATTAAAAAAGTTCATGTTGAGATAAATGGTAAAAAGCGAATTATTGAAGCAGAACAATTGCTAATTGCCACTGGAAGAAAACCAATACAGACATCATTAAACTTACATGCAGCAGGCGTTGAAGTTGGTTCCCGTGGTGAAATTGTCATTGATGATTATCTTAAAACGACCAATTCCCGAATTTATTCAGCTGGAGATGTCACTCCCGGTCCCCAATTTGTTTATGTAGCTGCTTATGAAGGTGGACTTGCTGCTCGTAATGCAATCGGAGGACTAAATCAAAAGGTCAATTTAGAAGTGGTTCCAGGCGTTACGTTTACTTCTCCATCGATTGCAACGGTTGGTTTAACGGAGCAACAGGCAAAAGAAAAAGGATATGAAGTGAAAACATCGGTATTGCCGTTGGATGCTGTTCCAAGAGCGCTCGTTAATCGGGAAACAACAGGTGTTTTCAAATTAGTGGCAGACGCGAAAACATTGAAAGTGTTAGGGGCGCATGTAGTGGCAGAAAACGCAGGAGACGTAATTTATGCAGCAACATTAGCTGTGAAATTCGGTTTAACTGTTGGAGATCTGAGAGAAACGATGGCTCCATATCTAACAATGGCAGAAGGATTGAAGCTGGCTGTCCTAACTTTTGATAAAGATGTTTCGAAATTATCTTGCTGTGCTGGATAA >>MEG_3839|Metals|Mercury_resistance|Mercury_resistance_protein|MERA ACGATCCGCAAGTAGCAACCGTGGGCTACAGCGAAGCGGAAGCGCATCACGACGGGATCGAAACCGACAGTCGCACGCTCACGCTCGACAACGTGCCGCGTGCGCTTGCCAACTTCGACACACGCGGCTTTATCAAGCTGGTCATCGAGGAAGGTAGCGGACGGCTCATCGGCGTGCAGGTCGTCGCCCCGGAAGCCGGCGAATTGATCCAGACGGCTGTTCTCGCCATTCGCAACCGCATGACGGTGCAGGAACTGGCCGACCAGTTGTTCCCCTACCTGACGATGGTCGAGGGGCTGAAGCTCGCGGCGCAGACCTTCACCAAGGATGTCAAACAATTGTCCTGCTGCGCAGGATGA >>MEG_3840|Metals|Mercury_resistance|Mercury_resistance_protein|MERA ATGACCCATCTAAAAATCACCGGCATGACCTGCGACTCGTGCGCGGCGCACGTCAAGGAAGCGCTGGAAAAAGTACCCGGCGTCCAATCTGCCATAGTGTCCTATGCCAAGGGCGCGGCCCAGCTCGCCCTTGATCCAGGCACAGCGCCGGACGCACTGACCGCCGCCGTGGCTGGCCTGGGCTACAAAGCGATGCTCGCCGATGCCCCGCCGACCGACAACCGCACTGGGCTGTTCGACAAGGTGCGCGGCTGGATGGGTGCCGCCGACAAGGGCAGCGGCGCCGAGCGCCCGTTGCAAGTCGCCGTGATCGGCAGCGGTGGAGCCGCGATGGCGGCAGCACTGAAGGCCGTCGAGCAAGGCGCGCAGGTCACGCTGATTGAGCGCGGCACCATCGGCGGCACCTGCGTCAACGTCGGTTGTGTGCCGTCCAAGATCATGATCCGCGCCGCCCACATCGCCCATCTGCGCCGGGAAAGCCCATTCGACGGCGGCATGCCACCCACACCGCCGACGATCTTGCGCGAGCGGCTGCTGGCCCAGCAGCAGGCCCGTGTCGAAGAACTCCGTCATGCCAAGTACGAAGGCATCCTGGACGGCAATTCAGCCATCACCGTTCGTCACGGTGAAGCGCGTTTCAAGGACGACCGAGACCTTAGCGTTAGTTTGAACGAGGGTGGTGAGCGCGTCGTGATGTTCGACCGCTGCCTGGTCGCCACGGGTGCCAGTCCGGCCATGCCGCCGATTCCGGGCCTGAAAGAGTCACCCTACTGGACTTCGACCGAGGCCTTGGTCAGCGACACCATTCCCGAACGCCTAGCCGTGATCGGCTCGTCGGTGGTCGCGCTGGAACTGGCGCAAGCCTTCGCCCGGCTGGGCAGCCAGGTCACGATCCTAGCTCGCAACACGCTGTTCTTCCGCGACGACCCGTCCATCGGCGAGGCCGTCACAGCCGCTTTCCGTGCCGAAGGGATCAAGGTACTGGAACACACGCAAGCCAGCCAGGTCGCGCATGTGAACGGCGAATT >>MEG_3841|Metals|Mercury_resistance|Mercury_resistance_protein|MERA ATGACTCAAAATTCATATAAAATACCCATTCAAGGCATGACATGCACAGGCTGTGAAGAACATGTAACCGAAGCATTGGAACAAGCCGGAGCTAAAGATGTTTCGGCCGATTTCCGACGCGGTGAGGCCATTTTTGAACTCAGCGATGATCAGATCGAAAAGGCTAAGCAAAATATTTCGGCAGCCGGCTATCAACCCGGAGAGGAAGAAAGCCAGCCCTCTGAAAACAGTGTAGATTTCAATCGGGATGGCGATTACGATCTTCTGATTATTGGTTCCGGCGGTGCGGCGTTTTCTGCAGCTATCAAGGCCAATGAAAACGGGGCGAAAGTGGCCATGGTAGAACGGGGAACCGTCGGGGGGACCTGCGTTAACATCGGTTGTGTACCGTCAAAAACCATGCTTCGTGCCGGTGAAATAAACGGTCTCGCCCAAAACAATCCGTTTACCGGACTTCAAACGAGTACCGGTGCTGCGGACCTTGCCCAATTGACCGAACAAAAAGATGGATTAGTCAGTCAAATGCGTCAAGAAAAATATATAGACTTGATCGAAGAATATGGATTTGATCTCATTCGTGGCGAGGCCTCGTTTATCGACGATAAGACGATACAAGTGAATGGACAAAACATCACGTCTAAAAGCTTTTTAATCGCAACGGGGGCTTCTCCGGCTGTTCCGGAAATCCCGGGAATGAATGAGGTTGATTATTTAACAAGTACATCCGCACTCGAATTAAAAGAGGTTCCACAACGATTGGCAGTGATCGGTTCTGGCTATATCGCAGCGGAATTAGGTCAAATGTTTCACAACCTCGGAACAGAAGTGACTCTCATGCAAAGAAGCGAGCGTCTGTTTAAAACCTACGATCCTGAAATTTCCGAAGCCATCGATGAATCCTTAACTGAGCAAGGACTTAACCTGATCACTGGGGTCACTTATCAAAAGGTTGAGCAAAACGGTAAGTCGACAAGCATTTATATTGAAGTGAACGGTCAAGAACAAGTCATCGAAGCCGATCAAGTCCTCGTGGCAACAGGAAGAAAGCCGAACACAGAGACTTTAAACCTTGAATCAGCAGGTGTGAAAACAGGGAAAAAAGGCGAAGTGCTGACCAATGAATATTTGCAAACGTCGAATAACCGAATATATGCCGCGGGCGATGTGACCCTCGGTCCGCAATTCGTTTATGTTGCAGCTTATGAAGGCGGGATTGTGGCAAATAATGCGTTGGGTCTAGCGAAACGCAAAATCGATCTTCGCTTTGTTCCCGGCGTAACCTTCACCAATCCATCGATCGCCACAGTCGGCTTGACTGAACAACAGGCAAAAGAAAAAGGTTACGATGTCAAAACATCGGTCCTTCCGTTGGACGCTGTACCGCGGGCCTTAGTCAATCACGAAACAACAGGGGTCTATAAACTTGTAGTCAACGCCCAAACCCAGAAATTGATCGGAGCGCACATTGTGAGTGAAAATGCTGGAGATGTGATTTATGCGGCAACGTTAGCGGTTCAATTTGGATTGACCATTGAAGACCTTACGGATAGCTTTGCGCCTTATTTAACGATGGCTGAAGGATTAAAGCTTGCAGCCTTGACGTTTGATAAAGACGTATCGAAATTATCTTGTTGTGCAGGCTAA >>MEG_3842|Metals|Mercury_resistance|Mercury_resistance_protein|MERA ATGACCCATCTAAAAATCACCGGCATCACTTGCGACTCGTGCGCGGGGCACGTCAAGGAAGCGCTGGAAAAAGTGCCAGGCGTGCAGTCGGCGCTGGTGTCCTATCCGAAGGGCACAGCGCAACTCGCCATCGTGCCGGGCACATCGCCGGACGCGCTGACTGCCGCCGTGGCCGGACTGGGCTACAAGGCAACGCTAGCCGATGCGCCACTGGCGGACAACCGCGTCGGACTGCTCGACAAGGTGCGGGGATGGATGGCCGCCGCCGAAAAGCACAGTGGCAACGAGCCCCCGGTGCAGGTAGCGGTCATTGGCAGCGGTGGAGCCGCGATGGCGGCGGCGCTGAAGGCCGTCGAGCAAGGCGCGCAGGTCACGCTGATCGAGCGCGGCACCATCGGCGGCACCTGCGTCAATCTCGGCTGTGTGCCGTCCAAGATCATGATCCGCGCCGCCCACATCGCCCATCTGCGCCGGGAAAGCCCGTTCGATGGCGGTATTGCGGCAACTGTGCCTACGATTGACCGCAGTAAGCTGCTGGCCCAGCAGCAGGCCCGCGTCGACGAACTGCGGCACGCCAAGTACGAAGGCATCCTGGGCGGTAATCCGGCCATCACCGTTGTGCACGGTGAGGCGCGCTTCAAGGACGACCAGAGCCTTACCGTCCGTTTGAACGAGGGTGGCGAGCGCGTCGTGATGTTCGACCGCTGCCTGGTCGCCACGGGTGCCAGCCCGGCGGTCCCGCCGATTCCGGGGTTGAAAGAGTCACCCTACTGGACTTCCACCGAGGCCCTGGCGAGCGACACCATTCCCGAACCCCTTGCCGTAATCGGCTCGTCGGTGGTGGCGCTGGAGCTGGCGCAAGCCTTTGCCCGGCTGGGCAGCAAGGTCACGGTCCTGGCGCGCAATACCTTGTTCTTCCGTGAAGACCCGGCCATCGGCGAGGCGGTGACAGCCGCTTTCCGTGCCGAGGGCATCGAGGTGCTGGAGCACACGCAAGCCAGCCAGGTCGCCCATATGGACGGTGAATTCGTGCTGACCACCACGCACGGTGAATTGCGCGCCGACAAACTGCTGGTTGCCACCGGTCGGACACCGAACACGCGCAGCCTCGCGCTGGACGCAGCGGGGGTCACTGTCAATGCGCAAGGGGCCATCGTTATCGACCAAGGCATGCGCACGAGCAACCCGAACATCTACGCGGCCGGCGACTGCACCGACCAGCCGCAGTTCGTCTACGTGGCAGCGGCCGCCGGCACCCGTGCCGCGATCAACATGACCGGCGGCGACGCAGCCCTCAATCTGACCGCGATGCCGGCAGTGGTGTTCACCGACCCGCAAGTCGCCACCGTGGGCTACAGCGAGGCGGAAGCGCACCACGATGGCATCGAGACCGACAGTCGCACGCTGACACTCGACAACGTTCCGCGAGCGCTTGCCAACTTCGACACACGCGGCTTCATCAAGCTGGTCATCGAGGAAGGTAGCGGACGGCTCATCGGCGTGCAGGCGGTGGCCCCGGAAGCGGGCGAACTGATCCAGACGGCGGTGCTCGCCATCCGCAACCGCATGACGGTGCAGGAACTGGCCGACCAGTTGTTCCCCTACCTGACAATGGTCGAGGGGTTGAAGCTTGCGGCGCAGACCTTCAACAAGGACGTGAAGCAGCTTTCCTGCTGCGCTGGATAA >>MEG_3843|Metals|Mercury_resistance|Mercury_resistance_protein|MERA ATGAAAAATACAGCTAAAATGAAAATCAAAATGCCTCAAAATAGAGAAACCATTACATTGGAAATCGAGGGTATGACCTGTGAAGCTTGTGCAACACATATCGAAAAGGATATGAACGCAACTGAAGGAGTTTTAAGTTCCACAGTTAACCACGAAACCGGAAAAGGCGAATTTAATTTTGATGCTGATAAGATGAGTAAGGCAAATGTAATAGATGCTATAAACAGCGTTGGTGATTATTCGGTTGTAAATAATGTCGACGAGGAAGAGGTTTCCGCTGTAAATTCCAAAGGCCAAAATAAATTCGATTTAATAATTATTGGTGGTGGTTCAGCTGCATTTTCAGCAGCCATTAAAGCTGAAGGTTTAGGGCTCACAACACTTATGGTAAATGCAGGATTAGATTTTGGTGGCACTTGCGTAAATGTGGGTTGTGTACCGTCTAAAAACCTTATTCGGGCTGCCGAAACGGTACGTCTCGCTACGCATTCCAATTTTAAGGGTATAAAACCTAGAGGAGCAGACATTGATTTTACACAAATCATAAAAGATAAAAAAGCATTGGTTGCTTCACTTCAGCAACAAAAATATATGGATGTGGTAAGTGATTTTGAAAACCTGATAATGCGTACAGGTTGGGCTGAACTTGTTGATAATAAAACAATCCTTGTGGATGGAAAAGACACCTACACAGCAACCAACATTCTAATGGCAACAGGAGCAACTACCAATATTCCAAATATTGAAGGACTGAATGAGGTTGGTTATTTAACCAATGTGACCTTGTTCGATTTAGAGGAAAAACCTGAAAGTTTGACCATTATGGGAGCTGGTTATATTGGTTTGGAAATTGCGATGGCTTACAACAGATTGGGTGTAAAAGTACGTATCATTGAATTTACCGACAGGCCATTACGCAGTCAAACAAAAGATATTACAGATGTTTTGGTAGAACAAATGAATAGTGAAGGAATTGAAATCCTTCCAAACTTTAGAGCTTTTAAATTTGAAAAGAAAGGTAACGATACAATTATTCATTGTAATTGTCCTGATGGTTCCACAACTCAAATTGTTGAAAAAGGACATATTGTGGTGGCTACAGGGACGAAGCCTAACACCTCTAATTTAGGGCTTGAGAATATTGGCCTAAAGTTAACAGAAAGCGGCCATATTATTGTAAATGAAAAGATGGAAACCAATATTTCCAATATTTATGCAGCAGGCGACGTCACCATTACACCGGCATTTGTTTATACAGCAGCAACCGAAGGTAGTACAGCAGTGAACAATGCGTTTTCATCAACAAAAACAAGTATTGATTATTCATCATTACCTTGGGTAGTATTTACAGACCCTCAAATCGCAGGAGCAGGTATAGATGAAATTGAAGCAGAAAAAAAGGAAATTCCTTTTGAAGTCAGTAAACTTGATTTAATTCACGTTCCAAGAGCCTTGGCAGCTCAAGACACCAGAGGGTTCATAAAACTGATACGCAACACTGAAACCGATAAATTAATAGGCGCAAGAGTAGTTGCACTTGAAGGTGGTGAACTGATACAACAATTGAGTATGGCTATTAAATTTGGAATCACTGTAAAAGATTTAGCAGAAAGCTTTTATCCATATTTAACTTTAGGAGAATCTGTTAAACTGGCAGCGATTACCTTTGGGAAAGATGTTTCCAAATTAAGTTGCTGCGCGAGTTAA >>MEG_3844|Metals|Mercury_resistance|Mercury_resistance_protein|MERA ATGCAAGAGTTAAACGAAGTTGGTTTGAGCGTGGCGGGAATGACTTGCCCAAGTTGTACAAGGCACGTTGAGGACGCGCTGCTGGCGGTCCCCGGCGTAACGCGAGCGGCTGTCGATTATCCATCGAACAAGGCGCAAGTCACAGGCAATAGGCTTGACGTGTCCGCGCTCGTAGCAGCAGTGGGCGCCCTTGGTTACGGTGCTACGCCTACAGACGAATTTGAAAGCAAAGAGCGCAGTGTTGAACAGCCAGGACTCCTTGGCAAAGCCGCCCAGTGGCTGAGCGGCGAGCGCGCGGTGGAGAAACCGGCAGGTCAGCTGCATGTGGCGATCATCGGTACTGGCGGCGCCGCTGTGGCAGCAGCGCTGAAGGCAGCTGAAAACGGTGCCCGTTTCACCCTGATCGAGCGGGGAACTATCGGCGGCACCTGCGTCAACGTGGGCTGCGTCCCTTCTAAGATCATGATTCGGGCAGCGCATATCGCTCATCTGCGACGCGAAAGTCCTTTTGACGTGGGACTGTCGGCAACGCCCCAGTTGTTCCTGCGTGACCGTCTGCTGGCGCAACAGCAGGCCCGTGTGGACGAGCTGCGTCATGCTAAATATGAAAGCATCCTCGAAAGCAATCCGTCGATCAATCTGGTGCGAGGCAGCGCCCGATTCAAGGATGGCCAAACGCTTATCGTGGAAGCGGCAGAAGGTGACACTCGCGAAGTGGCCTTCGATCGCTGTCTCATTGCCACTGGTGCAAGCGCTGCCATCCCGCCGTTGCCTGGTCTTGCAGGAACGCCATATTGGACGTCCACCGAAGCCCTGGTTAGCGAACGCATTCCTAAACGGCTGGCAGTAATTGGCGCCTCGGTCGTAGCACTGGAACTGGCACAAGCGTTTGCGCGCTTGGGCAGCGAGGTGACGGTCCTGGCCCGGCGCACCTTGTTTGCCAGTGACGACCCTGCCATTGGCGAGGCCGTGACTGCAGCTTTCCGTGCGGAAGGCATCACGGTGCTGACACAGACGCAGGCGAGTGCCGTGACCTATTGCGACCGCCAATTCATCCTGACGACCGCGCAGGGCGAGTTAAAGGTGGATCAATTGCTTGTTGCCACCGGCCGCACGCCAAATACCGCAAGCCTGAATCTCGAGCGCGCAGGTGTGACGTTTGACTCGCAACATCGCATCCTGATCGATCAAGGCATGCGCACGAGTGCTTCGAACATTTACGCAGCTGGCGACTGCACTGACCAGCCTCAGTACGTCTACGTTGCAGCCGCGGCTGGTACCCGGGCTGGCATTAATATGACCGGCGGCGACGTAAAGCTCGATCTCGACGCCATGCCGGCAGTCGTGTTCACCGATCCGCAAGTTGCCACGGTAGGCTACAGTGAAGCAGAGGCCCAGCGCATTGGTCTGCAAACCGAAAGCCGTACGCTCACGCTCGACAATGTGCCGCGTGCACTCGCCAACTTCGATACCCGCGGCTTTATCAAGCTTGTTGCTGAGGCAGGGTCCGGACGCATTCTCGGAGTCCAGGCTGTGACACCGGAAGCAGGCGAAATCATCCAGACTGCCGCGATTGCCATCCGGGCCCGCATGACCGTCCAGGATCTGGCTAACCAGCTTTTCCCTTACCTCACCATGGTTCAAGGTCTCAAACTGGTGGCACAGACTTTTTCGAAGGATGTGACACAGCTATCGTGCTGTGCCGGCTAA >>MEG_3845|Metals|Mercury_resistance|Mercury_resistance_protein|MERA ATGGCTGACACGATCACTTTTCAAATCGAGGGCATGACCTGCGACTCGTGCGCCGTGCACACACGGCAGGCTCTGGAGAGGGTGCCCGGCGTACGCTCTGCCTCGGTGTCCTATCCCCAGCAGCGAGCCGAGATCGAGGTGGACACCGGCGTGGGCCTGGACCCGCTAGTTGCCGCAGTGGCCGCGCTTGGCTACCGCGCCCGGCTCCCTGATACGCCGAATAAGCCCTCTGGTCTGTTGAACAAAGCGCTGGGCTGGCAGGACGGCGAAACGAGCGTAGCGTGCGATGATGAGGCGCTGCATATAGCCGTGATCGGTAGCGGTGGCGCGGCGATGGCGGCGGCACTTAAAGCCGTCGAGCAAGGTGCACGCGTGACGCTGATCGAGCGCGGCACCATCGGCGGCACCTGCGTGAATGTCGGTTGCGTGCCGTCCAAGATCATGATCCGAGCGGCGCACATCGCGCATATGCGCCGGGAAAGCCCATTCGATGGCGGCATCGCAGCGGCGGTGCCTGTGATTGACCGGGGCAAACTGCTGGCCCAGCAACAGGCTCGCGCCGATGAGCTGCGACACGTCAAGTACGAGGGCATCCTGGACGGCAATCCGGCCATCACCGTGCTGCACGGCGAGGCTCGTTTCAAGAGCGGCCATAGCCTCAACGTCCAATTGAACGATGGCGGCGAGCGCGAAGTGGCCTTCGACCGCTGCCTGATCGCCACCGGTGCCAGCCCGGCGATTCCGCCGATTCCCGGCTTGAAGGACACACCCTACTGGACTTCCACCGAGGCGCTGGTCAGCGACACGATTCCTGAGCGGCTGGCCGTGATCGGTTCGTCGGTGGTCGCGCTGGAACTGGCGCAAGCCTTCGCCCGGCTCGGCAGCCAGGTGACGATTCTGGCACGCGGCACGCTGTTTTTCCGGGAAGACTCGGCCATCGGCGAAGCCATCACGGCGGCGTTCCGCGCCGATGGCATCGAGGTACTGGAACACACGCAAGCCAGCCATGTCGCTTATGCGGTCGGCGAATTCGTGCTTGCCACCGGGAACGGAGAACTGCGCGCTGACAAGTTGCTGATCGCCACTGGTCGCGCACCGAACACACGCAGCCTGGCGCTGGAAGCTGCGGGCGTGGCCGTCAATGCGCAAGGGGCCATCGTCATCGACCAGGGTATGCGCACGAATAGCCCGAACATTTACGCCGCTGGCGACTGCACCGACCAGCCGCAATTCGTCTACGTGGCGGCAGCGGCCGGCACCCGTGCGGCCATCAACATGATGGGCGGTAGTGCGGCCCTGGACTTGACGGCGATGCCAGCCGTGGTGTTCACCGATCCGCAAGTGGCGACTGTGGGTTACAGCGAAGCGGAAGCGCACCACGACGGCATCGAAACCGACAGCCGCACGCTGACGCTCGACAACGTGCCGCGGGCGCTCGCCAATTTCGACACCCGTGGCTTCATCAAGCTGATAGCCGAGAAGGGTTCTGGCCGGTTGCTGGGTGCGCAGGTCGTGGCCCCGGAGGGCGGCGAAGTCATCCAGGTGGCGGCCCTGGCGATCCGCAACCGCATGACCGTCCAGGAACTGGCTGACCAGTTGTTCCCGTACCTGACGATGGTTGAGGGGCTGAAGCTCGCGGCGCAGACCTTCAACAAGGACGTGAAGCAGCTTTCCTGCTGCGCTGGGTGA >>MEG_3846|Metals|Mercury_resistance|Mercury_resistance_protein|MERB ttggacaagactatatattccaaaaagattgccgagagcctctcatctggcaatcatccagaagagttcgcaaccctcttcgtcaccctgcttcgtcagcttgtgatgggaaggcctgtgtcacgcgaagcgctcggcaccgcactcggatggtctgggcagagggttgcaactgtacttgagccggcgcccggtaccgaatatgacgagcagggcaatatcattggactgggcctgacgctacgcgaaacccctcacgtttttgaagtggatggccgccgtttatacacctggtgtgcgctcgacaccttgatgtttcccgctttgattggcaaaacagcccgtgtcacgtcgcgctgtgtcgccaccggcaggccgattacgctcacagttgcgccagaagcagtgcttcaggttgaaccggcggaaacaatggtgtctctgctaacgccggatgcttcacccgacattcgctgttccttttgctgtcatgtgcatttttttgcatcgccttctgttgcaaatgcatgggcttcgacgcacccggggatagagctcgtgcctgtcgagaatgcattcggtctcggacatctgatcgcgcataagctgttagaagacagcgagcgaaacacggcatga >>MEG_3847|Metals|Mercury_resistance|Mercury_resistance_protein|MERB ATGAAGCTCGCCCCATATATTTTAGAACGTCTCACTTCGGTCAATCGTACCAATGGTACTGCGGATCTCTTGGTCCCGCTACTGCGAGAGCTCGCCAAGGGGCGTCCGGTTTCACGAACGACACTTGCCGGGATTCTCGACTGGCCCGCTGAGCGAGTGGCCGCCGTACTCGAACAGGCCACCAGTACCGAATATGACAAAGATGGGAACATCATCGGCTACGGCCTCACCTTGCGCGAGACTTCGTATGTCTTTGAAATTGACGACCGCCGTCTGTATGCCTGGTGCGCGCTGGACACCTTGATATTTCCGGCGCTGATCGGCCGTACAGCTCGCGTCTCATCGCATTGCGCTGCAACCGGAGCACCCGTTTCACTCACGGTTTCACCCAGCGAGATACAGGCTGTCGAACCTGCCGGCATGGCGGTGTCCTTGGTATTGCCGCAGGAAGCAGCCGACGTTCGTCAGTCCTTCTGTTGCCATGTACATTTCTTTGCATCTGTCCCGACGGCGGAAGACTGGGCCTCCAAGCATCAAGGATTGGAAGGATTGGCGATCGTCAGTGTCCACGAGGCTTTCGGCTTGGGCCAGGAGTTTAATCGACATCTGTTGCAGACCATGTCATCTAGGACACCGTGA >>MEG_3848|Metals|Mercury_resistance|Mercury_resistance_protein|MERB ATGAAAAATATTTCAGAATTCTCAGCCCAACTTGATCAAACTTTTGATCAAGGGGAAGCCGTCTCTATGGAGTGGTTATTCCGTCCGTTGCTAAAAATGCTGGCGGAGGGCGATCCAGTCCCCGTTGAGGACATCGCGGCGGAGACCGGGAAGCCCGTCGAGGAAGTTAAGCAAGTCCTACAGACTCTACCTAGTGTGGAACTTGATGAGCAGGGCCGTGTCGTCGGTTATGGCCTCACACTGTTCCCTACCCCCCATCGCTTCGAGGTTGATGGGAAGCAACTATATGCATGGTGCGCCCTTGACACACTTATGTTCCCAGCACTCATCGGCCGGACGGTCCACATCGCTTCGCCTTGTCACGGCACCGGTAAGTCCGTCCGGTTGACGGTGGAACCGGACCGCGTTGTAAGCGTCGAGCCTTCAACAGCCGTTGTCTCGATTGTTACACCAGATGAAATGGCCTCGGTTCGGTCGGCCTTCTGTAACGACGTTCACTTTTTCAGTTCACCGAGTGCAGCCCAAGACTGGCTTAACCAACACCCTGAGTCGAGCGTTTTGCCCGTTGAAGATGCCTTTGAACTGGGTCGCCATTTGGGAGCGCGTTATGAGGAGTCAGGACCTACTAATGGGTCCTGTTGTAACATTTAA >>MEG_3849|Metals|Mercury_resistance|Mercury_resistance_protein|MERB ATGAATATATCGACCGAATCGCGACTGGAACTCAAAGCGGCGGTGACGCGTGCGCAGCAGAAGCTGGCGGACGAGTTTCCGTTGCAGGCACGGATCGAAGACGCGCATCCCACGCTGCAGTCGACCTATGCCAGGATTCTCGGTCATTGGATACGCGAAGCAGCACCGCCCGCAGCGGGGATTGGGTCGCAGGCGGTGCTCGACGCGCTGTGCGCGATGGATGCCATCGTCATCGGCGAGCAAGGCATCGGCTGCTATCCCTTCAGCGCTCGCCAGACTGAAATCCACGTTCATTTCGCCGGCAAGAGTGTCCATGCCATGTGCGCGATCGATGCGCTCGCGATTCCACGCATGGTGCGGCACGCCGCGCGCATCATAGCTCGGTGCGTGGTTTGCCGCTGCCACCTCGCCTGCTCGCTGGCGGCGAACGGCAGTGTCGAGAAGGAACATCAGAATCCGGAGGCCGCACGCGTCGTCTGGGAATCCGGTGCGGGAGAAGGACAAGCATGCTGCAACAGCTTATGCGCCAATATCAATTTTGTCTGCCGGCATTGCACGACTTCCCCAGGCGCACTCACCTTTTCTTTGCCACAAGCGGCTGCCGTGGGCAATGCCTTTTTCGCGTTCCAGAGGAGGCTGCTTGGCCACTATTCCACATGA >>MEG_3850|Metals|Mercury_resistance|Mercury_resistance_protein|MERB ATGGACAAGACTATTTATTCCAAAAAGATTGCCGAAAGCCTTTCATCTGGCAATCATCCTAAAGAGTTCGCAACGCTCTTTGTCGCGCTGCTCCGACAGCTAGCGATGGGGGGACCTGTATCACGCGAAAAGCTCGCCGGCGCACTCGGATGGTCTGGAGCGAGAGTTGCAACGGTACTTGAGCAGGCACCTGGTACGGAATATGACGACGAGGCCAATATCATTGGACTGGGGCTGACACTACGTGAAACCTCTCACGTTTTTGAGGTGGATGGCCGTCATTTGTACACATGGTGTGTGCTGGACACCTTGATGTTTCCCGCCTTGACCGGCAAGATTGCCCGTGTCACTTCCCGCTGCGCCGCCACCGGTAGGCCGATCACTCTCACCGTTGCACCAGAAGCAGTGCTTCATGTCGAACCGGCAGAAGCAATGGTTTCACTGCGAACTCCGGATACTTCGCCCGACATTCGTTGTTCGTTTTGCTGTCATGTGCATTTCTTTGCGTCTCCGTCTATTGCAAATTCGTGGGCTTCGACCCACCAAGGGATTGAGGTCGTGCCTGTCGAGAGTGCGTTCGACCTTGGTCATGATGTCGCGCTTAAGCTGCTAGAGGACTGCGAGGAAAGCCCAGTATGA >>MEG_3851|Metals|Mercury_resistance|Mercury_resistance_protein|MERB ATGAAAACTGAAATTCAGGAAATCGTAACCCGACTTGACCAACAGTCGAACAAGGGAGAGGGAGGAGAATCCATGAAGTGGCTGTTTCGCCCGTTGTTACAAATGCTAGCAGGGGGGGAGTCTGTCACCATTGAAGATATGGCGACAACGACCGGAAAACCTGTTGAAGAGGTGAAGAAAGTTCTCCAGTCTCTGCCAAGCGTGGAAATCGACGAACAAGGCCGTGTCGTTGGTTTAGGTCTTACCCTTATCCCTACCCCTCACCACTTTACGGTTGATGGGAAGCAACTATATGCCTGGTGCGCCCTTGACACACTTATATTTCCAGCACTCATCGGTCGTTCGGTCAACATCGAGTCACCCTGTCACAGCACCGGAGAACCTATACGGTTGAATGTGGAACCGGACCACATTGTAAGCGTGGAACCTTCCACTGCCGTTGTCTCAATCGTGACGCCAGATGATATGTCCTCGATTCGTACGGCATTCTGCAACGAAGTCCATTTCTTCAGCTCACCGAATGCAGCCGAAGACTGGCTTGACCAACATCCAGGGGGGAAAGTGTTATCTGTAGAAGATGCCTTTGAACTGGGTCGCCTAATGGGGACGCGTTACGAGGAATCTAGACCTGCCAATGGGTCATGCTGTCACATTTAG >>MEG_3852|Metals|Mercury_resistance|Mercury_resistance_protein|MERB ATTCAGGAAATCGTAACCCGACTTGACCAACAGTCGAACAAGGGAGAGGGAGGAGAATCCATGAAGTGGCTGTTTCGCCCGTTGTTACAAATGCTAGCAGGGGGGGAGTCTGTCACCATTGAAGATATGGCGACAACGACCGGAAAACCTGTTGAAGAGGTGAAGAAAGTTCTCCAGTCTCTGCCAAGCGTGGAAATCGACGAACAAGGCCGTGTCGTTGGTTTAGGTCTTACCCTTATCCCTACCCCTCACCACTTTACGGTTGATGGGAAGCAACTATATGCCTGGTGCGCCCTTGACACACTTATATTTCCAGCACTCATCGGTCGTTCGGTCAACATCGAGTCACCCTGTCACAGCACCGGAGAACCTATACGGTTGAATGTGGAACCGGACCACATTGTAAGCGTGGAACCTTCCACTGCCGTTGTCTCAATCGTGACGCCAGATGATATGTCCTCGATTCGTACGGCATTCTGCAACGAAGTCCATTTCTTCAGCTCACCGAATGCAGCCGAAGACTGGCTTGACCAACATCCAGGGGGAAAAGTGTTATCTGTAGAAGATGCCTTTGAACTGGGTCGCCTAATGGGGACGCGTTACGAGGAATCTAGACCTGCCAATGGGTCATGCTGTGACATTTAG >>MEG_3853|Metals|Mercury_resistance|Mercury_resistance_protein|MERB ATGAAAACTGAAATTCAGGAAATCGTAACCCGACTTGACCAACAGTCGAACAAGGGAGAGGGAGGAGAATCCATGAAGTGGCTGTTTCGCCCGTTGTTACAAATGCTAGCAGGGGGGGAGTCTGTCACCATTGAAGATATGGCGACAACGACCGGAAAACCTGTTGAAGAGGTGAAGAAAGTTCTCCAGTCTCTGCCAAGCGTGGAAATCGACGAACAAGGCCGTGTCGTTGGTTTAGGTCTTACCCTTATCCCTACCCCTCACCACTTTACGGTTGATGGGAAGCAACTATATGCCTGGTGCGCCCTTGACACACTTATATTTCCAGCACTCATCGGTCGTTCGGTCAACATCGAGTCACCCTGTCACAGCACCGGAGAACCTATACGGTTGAATGTGGAACCGGACCACATTGTAAGCGTGGAACCTTCCACTGCCGTTGTCTCAATCGTGACGCCAGATGATATGTCCTCGATTCGTACGGCATTCTGCAACGAAGTCCATTTCTTCAGCTCACCGAATGCAGCCGAAGACTGGCTTGACCAACATCCAGGGGGGAAAGTGTTATCTGTAGAAGATGCCTTTGAACTGGGTCGCCTAATGGGGACGCGTTACGAGGAATCTAGACCTGCCAATGGGTCATGCTGTGACATTTAG >>MEG_3854|Metals|Mercury_resistance|Mercury_resistance_protein|MERB ATGAAGAATAAAACAGAACTCAAAAAATTTTATGAACTATTGTTAGCTAAGCTGCCTAAAGAATCAGTGCCTATTCTTCGGACAATTTTTTTCTCCATTCGTGATGGGCAGGCAGTTACAGAAAGTTCTTTAATAAATCAAACGGGAATTAATACAAAAACAGTTCAGTCAGTAGTGAAGATATTAGCCCAACGGCAGATGATCGTTCGGGAGGCGGATCAAAAAATAGTAGGGGCATTGGGCTTATCGATTATACCGACTACTAACCAGATTCATTTAGGAGGACGAACTTTATTTGCCTGGTGTGCAATATCGACATTGGAGCTGTCAACTGCTCTGGTTGCTGATGTCGATATACATTCCCGTTGTGCGTACACAGGTGAACCGATTGAGGTAACTGTCCGAAATGGAAAATTAGCAAAAACAACTCCTGATTCAACAGTAATCTGGACAGTGCCGTTTGATTCTGAGGCTCCATGGGCCGGAGGAACATGTAAACAAATTCACTATTTTAGCTCAGTTGAGCATGCAAACAAGTGGAAAGAAGAACATCCAAAATTGCAAGGGGAAATTATGACTTTGGAACAAGCTCTCTCTTTTGGAAACGAATTGAAAAAATTTTTATCATAG >>MEG_3855|Metals|Mercury_resistance|Mercury_resistance_protein|MERB ATGAATCAAAATCATTTGAATACTTCGTTAAAGGACAAGGTGTTACAATCACTTGGTTTGCCAGAAGAAGGATTTGAGGGAAAAATCCGTTTATTGTCTCCTTCAGAAAATAGTATCCGTTTAGACATTCTTCTTTTCATGGCTGAGGGAAAAATCGTCAACATCAATGATTTAACTGCAACAGAGGAACAAATTGATGTCCAATCTGCTCTTCAACGTTTAAGGGAATTGGATTTAATTCACTGGGACCAAAACTCTGGGGATGTGAACGTGGCGTATCCTTTTTCAGGAGTTCCGACTCCACACCGTGTTACATTGGCTGGAATGTTGCCAGCTTATTCCATGTGTGCGATTGATGCCCTTGGCATTCCATCGATGTTTACAGATGCCGTTATTGAATCGGAATGTGCATTTTGCGGTGAAAAGATTACCATCGATGTGAAAAACAACATGCCCGTTGCCAATCCTGATACCGTGGTTGTAGGCTTGGGAACAACGGATGCTGCCGATACCAACGCATGCTGCGATTCTTCTTGCGAATCGAATGAGCCAACGTCCATTTCTACCAGCTGTTGCCCAGCCATTCAATTTTATTGTTCTGAGGAACATTGGCAAAAAGCGAATGAAAAGAATTCAACAACGGCGAAGGACAAGCTGACTCTTGCGGAAGCCTTTGAGGTTGGGGCTGCTGTTTTTGGCGGCACGTTATCTGGCTCTAAGGGTAAGTAA >>MEG_3856|Metals|Mercury_resistance|Mercury_resistance_protein|MERB ATGAATCAAAATCATTTGAATACTTCGTTAAAGGACAAGGTGTTACAATCACTTGGTTTGCCAGAAGAAGGATTTGAGGGAAAAATCCGTTTATTGTCTCCTTCAGAAAATAGTATCCGTTTAGACATTCTTCTTTTCATGGCTGAGGGAAAAATCGTCAACATCAATGATTTAACTGCAACAGAGGAACAAATTGATGTCCAATCTGCTCTTCAACGTTTAAGGGAATTGGATTTAATTCACTGGGACCAAAACTCTGGGGATGTGAACGTGGCGTATCCTTTTTCAGGAGTTCCGACTCCACACCGTGTTACATTGGCTGGAATGTTGCCAGCTTATTCCATGTGTGCGATTGATGCCCTTGGCATTCCATCGATGTTTACAGATGCCGTTATTGAATCGGAATGTGCATTTTGCGGTGAAAAGATTACCATCGATGTGAAAAACAACATGCCCGTTGCCAATCCTGATACCGTGGTTGTAGGCTTGGGAACAACGGATGCTGCCGATACCAAGCATGCTGCGATTCTTCTTGCGAATCGAATGAGCCAACGTCCATTTCTACCAGCTGTTGCCCAGCCATTCAATTTTATTGTTCTGAGGAACATTGGCAAAAAGCGAATGAAAAGAATTCAACAACGGCGAAGGACAAGCTGA >>MEG_3857|Metals|Mercury_resistance|Mercury_resistance_protein|MERC atgggactgatgacacgcattgccgataaaaccggcgcgctcggcagcgtcgtttccgcgatgggctgcgccgcctgctttccagccctcgccagcttcggcgcggccatcgggctgggcttcttgagccagtacgagggactgttcatcagccgcctgctgccgctgtttgccgcgctggccttcctggcgaacgcgctgggttggttcagtcatcggcaatggctgcgcagtctgctcggcatgatcggcccggccatcgtgtttgcggccacggtctggctgctcggcaactggtggacggcgaacctgatgtacgtcggcctggccttgatgattggggtgtcgatctgggacttcgtgtcgccggcgcatcgccgttgcggaccggacggctgcgaactccccgccaagcgcttgtga >>MEG_3858|Metals|Mercury_resistance|Mercury_resistance_protein|MERC ATGTCCTTAATCACACGAGTGACCGACAAGGCCGGTTCCCTCGGCAGCGTCGTTTCTGCGATGGGCTGCGCCACCTGCTTTCCCGCCATCGCCAGCCTGGCCGCAGCGATCGGGCTGGGCTTCCTGAGTCAGTACGAAGGGCTGTTCATTCGCATCCTGCTGCCGACGTTCGCCGGCATCGCGCTATTTGCCAATGCGATCAGTTGGCGCAATCATCGGCAGTGGCGACGGACTGCGCCCGGCGTGATCGGCCCTGTCCTGGTGCTGGCAGCGGTGTTTTTGATGCGGGCTTACGGCTGGCGGAGCGGTTGGCTGCTGTATATCGGCCTGGCCTTCATGGTCGGGGTATCGATTTGGGATTTCATCTCGCCAGCAAAGCCCTGCTGTGGCCCGGACAGCTGCGAACTGCCACCAAACGCCGGATGA >>MEG_3859|Metals|Mercury_resistance|Mercury_resistance_protein|MERC ATGTCAGCCATAACCCGCATCATCGACAAAATTGGCATAGTCGGTACCATCGTCGGTAGTTTCAGTTGCGCCATGTGTTTCCCCGCAGCAGCGAGCCTCGGCGCTGCAATCGGATTGGGCTTTCTCAGCCAGTGGGAAGGCCTGTTCGTGCAGTGGCTGATTCCGATTTTCGCCAGCGTGGCATTATTGGCGACCTTGGCGGGCTGGTTCTCGCACCGCCAATGGCAACGCACGCTGCTGGGCTCGATCGGTCCGGTGCTAGCGCTTGTCGGGGTGTTTGGGTTAACGCATCACTTTCTGGACAAGGACCTGGCGCGCGTAATTTTTTATACCGGATTGGTGGTGATGTTCCTTGTCTCCATCTGGGACATGGTCAATCCGGCGAACCGCCGCTGCGCGACCGACGGCTGCGAAACGCCCGCCCCGCGTAGCTGA >>MEG_3860|Metals|Mercury_resistance|Mercury_resistance_regulator|MERD ATGAACGCCTACACGGTGTCCCGGCTGGCCCTTGATGCCGGGGTGAGCGTGCATATCGTGCGCGACTACCTGCTGCGCGGATTGCTGCGGCCAGTCGCCTGCACCACGGGTGGCTACGGCCTGTTCGATGACGCCGCCTTGCAGCGACTGTGCTTCGTGCGGGCCGCCTTCGAGGCGGGCATCGGCCTCGGCGCATTGGCGCGGCTGTGCCGGGCGCTGGATGCGGCGAACTGCGATGAAACTGCCGCGCAGCTTGCTGTGCTGCGTCAGTTCGTCGAACGCCGGCGCGAAGCGTTGGCCAATCTGGAAGTGCAGTTGGCCGCCATGCCGACCGCGCCGGCACAGCATGCGGAGAGTTTGCCATGA >>MEG_3861|Metals|Mercury_resistance|Mercury_resistance_regulator|MERD ATGAGCGCCTACACCGTGTCCCGGCTGGCCCTTGATGCCGGGGTGAGCGTGCATATCGTGCGCGACTACCTGCTGCGCGGATTGCTGCGTCCGGTGGCGTGCACCCCGGGCGGCTATGGCCTGTTCGATGATGCCGCCTTGCAACGGCTGTGCTTCGTGCGGGCGGCCTTCGAGGCGGGCATCGGCCTCGACGCGCTGGCGCGGCTGTGCCGGGCGCTGGATGCGGCGGACGGCGACGAAGCGGCCGCGCAGCTTGCCCTGCTGCGTCAGTTCGTCGAGCGTCGGCGCGAAGCGTTGGCCGATCTGGAAGTGCAGTTGGCCACCCTGCCGACCGAGCCGGCACAGCACGCGGAGAGTCTGCCATGA >>MEG_3862|Metals|Mercury_resistance|Mercury_resistance_regulator|MERD ATGAGCGCCTACACCGTGTCCCGGCTGGCCCTTGATGCCGGGGTGAGCGTGCATATCGTGCGCGACTACCTGCTGCGCGGATTGCTGCGTCCGGTGGCGTGCACCCCGGGCGGCTATGGCCTGTTCGATGATGCCGCCTTGCAACGGCTGTGCTTCGTGCGGGCGGCCTTCGAGGCGGGCATCAGCTCCGACGCGCTGGCGCGGCTGTGCCGGGCGCTGGATGCGGCGGACGGCGACGAAGCGGCCGCGCAGCTTGCCGTTCTGCGTCAGTTCGTCGAGCGTCGGCGCGAAGCGTTGGCCGATCTGGAAGTGCAGTTGGCCACCCTGCCGACCGAGCCGGCACAGCACGCGGAGAGTCTGCCATGA >>MEG_3863|Metals|Mercury_resistance|Mercury_resistance_regulator|MERD ATGAACGCCTACACGGTGTCCCGGCTGGCTCTTGATGCCGGGGTGAGCGTGCATATCGTGCGCGACTACCTGCTGCGCGGATTGCTGCGCCCGGTGGCGTGCACACCAGGCGGCTACGGCTTGTTCGATGACGCCGCCTTGCAACGGCTGTGCTTCGTGCGGGCGGCCTTCGAGGCGGGCATCGGCCTCGACGCGCTGGCGCGGCTGTGCCGGGCGCTGGATGCGGCGGACGGCGACGAAGCGGCCGCGCAGCTTGCCCTGCTGCGTCAGTTCGTCGAGCGTCGGCGCGAAGCGTTGGCCGATCTGGAAGTGCAGTTGGCCACCCTGCCGACCGAGCCGGCACAGCACGCGGAGAGTCTGCCATGA >>MEG_3864|Metals|Mercury_resistance|Mercury_resistance_regulator|MERD ATGAACGCCTACACGGTGTCCCGGCTGGCCCTTGATGCCGGGGTGAGCGTGCATATCGTGCGCGACTACCTGCTGCGCGGATTGCTGCGGCCAGTCGCCTGCACCACGGGTGGCTACGGCCTGTTCGATGACGCCGCCTTGCAGCGACTGTGCTTCGTGCGGGCCGCCTTCGAGGCGGGCATCGGCCTCGGCGCATTGGCGCCGCTGTGCCGGGCGCTGGATGCGGCGAACTGCGATGAAACTGCCGCGCACCTTGTTGTGTTGCGTCAGTTCGTCAAACGCCGGCGCGAAACCTTGGCCATTCTGGAAATTCATTTGGCCGCCATGCCGACCGCGCCGGCACAGCATGCGGAGAGTTTGCCATGA >>MEG_3865|Metals|Mercury_resistance|Mercury_resistance_regulator|MERD ATGAACGCCTACCCGGTGTCCCGGCTGGCTCTTGATGCCGGGGTGAGCGTGCATATCGTGCGCGACTACCTGCTGCGCGGATTGCTGCGCCCGGTGGCGTGCACACCAGGCGGCTACGGCTTGTTCGATGACGCCGCCTTGCAACGGCTGTGCTTCGTGCGGGCGGCCTTCGAGGCGGGCATCGGCCTCGACGCGCTGGCGCGGCTGTGCCGGGCGCTGGATGCGGCGGACGGCGACGAAGCGGCCGCGCAGCTTGCCCTGCTGCGTCAGTTCGTCGAGCGTCGGCGCGAAGCGTTGGCCGATCTGGAAGTGCAGTTGGCCACCCTGCCGACCGAGCCGGCACAGCACGCGGAGAGTCTGCCATGA >>MEG_3866|Metals|Mercury_resistance|Mercury_resistance_protein|MERE ATGAACAGCCCCGAGCGCATGCCGGCCGAGACACACAAGCCGTTCACCGGCTACCTGTGGGGTGCGCTGGCGGTGCTCACCTGTCCCTGTCATTTGCCGATTCTCGCCATTGTGCTGGCCGGCACGAAGGCCGGTGCGTTCATCGGACAGCACTGGGGTATTGCAGCCCTCACGCTGACCGGCTTGTTTGTCCTGTCTGTGACGCGGCTGCTGCGGGCCTTCAGAGGTCGATCATGA >>MEG_3867|Metals|Mercury_resistance|Mercury_resistance_protein|MERE ATGAACAACCCCGAGCGCTTGCCGTCCGAGACGCACAAACCGATCACCGGCTACCTGTGGGGCGGACTGGCTGTGCTGACTTGCCCCTGCCACCTGCCCATCCTCGCTGTCGTGCTGGCCGGCACAACCGCCGGTGCTTTCCTCGGCGAGCATTGGGTCATCGCGGCGCTCGGTTTGACCGGCCTGTTCCTTCTGTCCCTGTCGCGGGCGTTGCGGGCATTCAGGGAAAGAGAATGA >>MEG_3868|Metals|Mercury_resistance|Mercury_resistance_protein|MERE ATGAACAGCCCCGAGCGCTTGCCGTCCGAGACGCACAAACCGATCACCGGCTACCTGTGGGGCGCGCTGGCCGTGCTCACCTGTCCCTGCCATTTGCCGATTCTCGCCATTGTGCTGGCCGGCACGACGGCCGGCGCGTTCATCGGAGAGTACTGGGGTATCGCAGCCCTCACGCTGACCGGTTTGTTCGTCCTGTCTGTGACACGACTGCTGCGGGCCTTCAAAGATCGATCATGA >>MEG_3869|Metals|Mercury_resistance|Mercury_resistance_protein|MERF atgtgcaacccaaaaccgctgttgaagatcggcgtgagcggatcggtagtggcggcattgtgttgtttcacgccagtgttggtgattctgctcggggtatttggcctatccgcctgggtcggctacctggactacgtactgtttccggcgctcagtgcatttatcgcgctgaccctttatgccctgcacaagaagcgtaaagccgaggcctgctgcacagccgattcgaagatgggagaaaagtga >>MEG_3870|Metals|Mercury_resistance|Mercury_resistance_protein|MERF ATGAAAGACCCGAAGACACTGCTGCGGGTCAGCATCATTGGCACAACCCTCGTGGCGCTGTGTTGCTTCACCCCTGTTCTGGTCATTTTGCTCGGTGTGGTCGGCTTGTCCGCGCTGACCGGCTATCTGGACTATGTGCTGCTGCCTGCGCTGGCGATTTTCATCGGCTTGACCATCTACGCCATCCAACGAAAACGCCAAGCCGATGCCTGCTGCACCCCGAAATTCAATGGAGTAAAAAAATGA >>MEG_3871|Metals|Mercury_resistance|Mercury_resistance_protein|MERG ATGTTTTGTGACATCAGACTTAAATTACGCCGTGTACGCGCGTGCTTGACGATCGTACTGGCAAGTACCGCAACGTTAGGCATGCCAAACCAAGCGTTGGCGGCTTATGATTTTTCTAAGCTCGGCGCCGCGATTGAAACATTGTCGCCAGAGACCGTCAGTGATTGGGAAAAGAAGGCCAGGGCTGGCGATGCCATGGCTCAGAACATCATGGGTCTTGCGTACAAATGCGGTATGGGCGTAAAGCAAAACCACGCGGCATCGATCCAGTGGTTCCGCAGGGCGGCCGAGCAGGGTGAAGCCGATGCACAGTTCAACCTCGGGCGCCTCTACGGAAGTGAAGTCGACGGTATGTATAAGAATGGGCGTGCGGCTCCTGCCAACGATGCAGAGGCTTTCAAGTGGTACCGCCTCGCTGCCGAGCAGGGACACACGCAGGCTCAAGTCAGGCTGGCCCAGCTGTTTGCAAAGGGTCTTACCGACATCGCGCCCGACCAGGTGCAGGCATACCAGTGGATGAGTCTGGCCGCAGCGTCGGGAGAACCGACAGCAGCAAAAGTCGTTGCAGACTATGCAGCTCAAATGAAGCCCGAACAGTTACAGCAAGCCCAGCTGCTGGCCGAGGAATGGCAACGCCGGCAAGGCACAAAGTAA >>MEG_3872|Metals|Mercury_resistance|Mercury_resistance_protein|MERH ATGACTGTGCCCCCCACCCCCGCCATCGACCACGCAACTACCGCGTTGCCGCCCAGGTGGCAGCGCTGGCTGCCCCGCGCCGCCGCCCTGATGGCGGGTTTCGCCACTTTGTGTTGCCTCGGTGTGACGGCGCTGGTGTCGCTGCTCACCGCCATCGGCGCCACGTTCCTGACTACCGACGCCGCCCTGCGGCCGCTGCTGATCGTCAGCTTGGTGATCACCATCGCCGGTAGCGCGGCCACCTGGCATCGGCACCGCAACCCGCTGCCGCTGCTACTGACCGTGGTCGCCGCGGTGATCATCTTCTTGTCCCTCAACGGCAACGCCCTGTTCGGCCACGCCAGCGCCGGGCACGGCGGCGATCCCATGGGCGACGGCATGGGAGGCCACACCGCCGGCGCCGGCATGCCCGGCGGGGTGGGGGTGTGGATCGGGTTGGCACTGCTGATCATCGCCCAGGTGTGGGACATCTGGCGGCTACGCCAACTCAAACGCCAGAATGCCTGCGCCGCTTGA >>MEG_3873|Metals|Mercury_resistance|Mercury_resistance_protein|MERP ATGAAAAAACTGTTTGCCTCTCTCGCCATCGCTGCCGTTGTTGCCCCCGTGTGGGCCGCCACCCAGACCGTCACGCTGTCCGTACCGGGCATGACCTGCTCCGCTTGTCCGATCACCGTTAAGAAGGCGATTTCCAAGGTCGAAGGCGTCAGCAAAGTTAACGTGACCTTCGAGACACGCGAAGCGGTTGTCACCTTCGATGATGCCAAGACCAGCGTGCAGAAGCTGACCAAGGCCACCGAAGACGCGGGCTATCCGTCCAGCGTCAAGAAGTGA >>MEG_3874|Metals|Mercury_resistance|Mercury_resistance_protein|MERP ATGAAGAAACTGTTTGCCTCCCTCGCCCTCGCCGCCGTTGTTGCCCCCGTCTGGGCCGCCACCCAGACCGTCACGCTGTCCGTACCGGGCATGACCTGCTCCGCCTGCCCGATCACTGTCAAGAAGGCGATTTCCAAGGTCGAAGGCGTCAGCAAAGTTGACGTGACTTTCGAGACACGCCAAGCGGTCGTCACCTTCGACGATGCCAAGACCAGCGTGCAGAAGCTGACCAAGGCAACCGCAGACGCGGGCTATCCGTCCAGCGTCAAGCAGTGA >>MEG_3875|Metals|Mercury_resistance|Mercury_resistance_protein|MERP ATGAAAAAACTGTTTGCCTCCCTGTTGCTTGCTGCCGCCATCGTTCCCGCCTGGGCCGCCGTGCAAACCGTTACCCTGTCGGTGCCGGGCATGACCTGCGCCGCCTGCCCGATTACCGTCAAGAAGGCGATTTCCAAGGTCGAAGGCGTCAGCAAAGTTGACGTGACCTTCGAGACACGTGAAGCGGTTGTCACGTTCGATGATGCCAAGACCAGCGTGCAGAAACTGACCAAGGCCACCGGAGACGCGGGCTATCCGTCCTCAGTTAAGCGTTGA >>MEG_3876|Metals|Mercury_resistance|Mercury_resistance_protein|MERP ATGAAAAAACTATCAATAGTGCCTATTTTGGCTTTAATGCTGTTTTCTTTTCAGGCCAAATCACAAAGCAAGGAGGTTACAAATCAAGTTGTGGAAGTAGCTTCAAAGAAACATAATGCAATCACGGTGAAATTTAAAATTACAGGCATTACTTGTGCTGGTTGTTCCAATGCTATTTATAATGCATTAAAGGAAGTAGATGGTGTTTTGGAACATTCGGTTGAATACCCTGGAGATATTGCTGTTATTGAGTTTGATGGTTCAAAAACAAGTATCAAAGCCCTAAAACTTATCATAGAAAAGAAAGGGTTTAAGGCCGAAGTAATTAAAGGGAAGGTCTAA >>MEG_3877|Metals|Mercury_resistance|Mercury_resistance_protein|MERP ATGAAGAAACTGTTTGCCTCCCTTGCCCTCGCCGCCGCTGTTGCCCCGGTGTGGGCCGCCACGCAGACGGTCACCTTGGCAGTTCCTGGCATGACCTGCGCGACTTGTCCTATCACCATTAAAAAGGCCTTGAGCAAGGTCGACGGTGTTAGCAAGACCGAGGTCGACTTCTCAACCAAGCTTGCCGTCGTAACGTTTGACGATGCGAAGACCAACGTCCAGGCGCTTAGCAAGGCGACGACGGATGTAGGCTACCCATCTGAGCTGAAGAAGTAA >>MEG_3878|Metals|Mercury_resistance|Mercury_resistance_protein|MERP ATGATGTTGCTATCCCTTATGCTAGTGGTTAGTGCATGCAGTAACGAACAAGAAGTCCAAAAAACTGAAGTATCTAAGAGTGAAGTGAAAACAACTGCTATGAATTCAGAGAAGGATGTAAAAGCTATTACTGAAGCTGAGAAGACGGGGACATTCATGGTTATAGCAGGGATGGATTGCTGCCCGCCATCAGTTGTGGAAGATGCCATTGCACAGGTTGAAGGTGCTGGCAAAACAGCCATTAAAGTTAATGGAAGCACCGCGGAAGTAACGGTTTCTTTTGATGATACGAAAACCAATTTAGATGCAATTAAGACGGAGGTTTCAGACTTGGGTCTCCCCGTCGAATAA >>MEG_3879|Metals|Mercury_resistance|Mercury_resistance_protein|MERP ATGAAAAAAATCGCGACCCTTCTTGCCCTGTCCGCTGCCCTGAGCGCGCCCGCCTGGGCCGTAACCCAGACCGTCACGCTGTCGATTCCTGGCATGACCTGCGGCGCCTGCCCGATTACCGTGCGCACTGCACTCAAGCGAGTGCCTGGCGTGGAAAAGGTTGGCATCGACGAGGCGCAAAAACTGGTCACCGTCACCTACGACGACAGCAAGACCAACGTGCAGGCCCTGACCCAGGCAACCAAGGATGCTGGCTACCCTTCCAGCATCAAGCAGTGA >>MEG_3880|Metals|Mercury_resistance|Mercury_resistance_regulator|MERR ATGGAAAAAAATTTGGAGAATCTGACTATTGGCGTTTTCGCCAAGGCGGCCGGGGTCAACGTGGAAACAATCCGGTTCTATCAGCGCAAGGGCTTGTTGCCGGAGCCGGACAAGCCCTATGGCAGCATCCGCCGCTATGGCGAGGCGGATGTGACGCGGGTGCGCTTCGTGAAATCAGCCCAGCGGCTCGGATTCAGCCTCGACGAGATCGCAGAGCTGCTGAGGCTGGATGACGGCACCCACTGCGAGGAAGCCAGCAGCCTGGCCGAGCACAAGCTTCAGGACGTGCGCGAAAAAATGACCGACCTGGCGCGCATGGAAACCGTGCTATCCGAACTTGTGTTCGCCTGCCATGCGCGGCAAGGGAACGTTTCTTGCCCGCTGATTGCTTCGCTGCAAGGGGAGAAAGAGCCGCGTGGTGCCGACGCGGTGTAG >>MEG_3881|Metals|Mercury_resistance|Mercury_resistance_regulator|MERR ATGGGGATGAAAATCAGTGAATTGGCTAAAGCGTGTGATGTGAATAAAGAAACCGTTCGGTATTACGAGCGGAAAGGATTGATAGCCGGGCCTCCCAGAAACGAATCAGGGTATCGAATATATTCAGAGGAAACAGCAGATCGGGTACGGTTTATTAAACGAATGAAGGAATTGGATTTCTCGCTAAAGGAAATCCACCTGTTGTTTGGTGTGGTTGATCAAGATGGGGAGAGATGTAAAGATATGTACGCCTTTACCGTTCAAAAAACCAAAGAAATCGAGCGGAAAGTGCAGGGTTTGTTACGAATCCAACGGTTATTAGAGGAATTAAAAGAAAAGTGTCCAGATGAAAAGGCGATGTATACCTGTCCTATTATTGAAACGTTAATGGGAGGGCCTGATAAATAA >>MEG_3882|Metals|Mercury_resistance|Mercury_resistance_regulator|MERR ATGAAAAATAATTCTTGCATAAGACAACAGGCAGATATTGAACAGATAAACCGTTGTAAAAAGACAGTTTCAGAATTAAATGAATCGTTTGACTATTTGGCAAATGGACTTTCTTTAGTCGGAAATAATGTTCGGCTAAAAATTCTTTACCTACTCTTTGAGGAGAAACGACTTTGCGTTTGCGACTTAAGTGATATTCTCGAAATGAATATTTCTGCTATCTCTCAACATTTGAGAAAAATGAAGGACAGAAATTTATTGGAAACCGAAAGAGATGCTCAAACGATTTTTTACTCACTAACCCCTGAATATTCAACATTATTAAATCCGTTTTTTGAAATACTCGATAAAAACAAAGTTTTAGAAACGATATGA >>MEG_3883|Metals|Mercury_resistance|Mercury_resistance_regulator|MERR ATGGAAAACAATTTGGAGAACCTGACCATTGGCGTTTTCGCCAAGGCGGCCGGGGTCAATGTGGAGACCATCCGTTTCTATCAGCGCAAGGGCTTGTTGCTGGAGCCTGACAAGCCCTATGGCAGCATCCGCCGCTATGGCGAGGCGGATGTAACGCGGGTGCGCTTCGTGAAATCAGCCCAGCGGCTGGGCTTCAGCCTGGATGAGATCGCCGAGCTGCTGCGGCTGGAGGATGGCACCCATTGCGAGGAAGCCAGCAGTCTGGCCGAGCACAAGCTCAAGGACGTGCGCGAGAAAATGGCTGACCTGGCGCGCATGGAGGCCGTGCTGTCTGAGTTGGTGTGCGCCTGCCATGCGCGAAGGGGGAACGTTTCCTGCCCGCTGATCGCGTCACTACAGGGTGGAGCAAGCTTGGCAGGTTCGGCTATGCCTTAG >>MEG_3884|Metals|Mercury_resistance|Mercury_resistance_regulator|MERR ATGGAAAACAATTTGGAGAATCTGACCATCGGCGTTTTCGCCAAGGCAGCCGGGGTCAACGTGGAGACCATCCGGTTCTATCAGCGCAGGGGCTTATTGCCGGAGCCGGACAAGCCCTATGGCAGCATCCGCCGCTATGGCGAGGTGGATGTAACACGGGTGCGCTTTGTGAAATCAGCCCAGCGGCTGGGCTTCAGCCTAGACGAGATTGCCGAGTTGCTGCGGCTGGAGGTAGGTACCCATTGCGTGGAAGCCAGCAGTCTGGCCGAGCTCAAGCTCCAGGACGTGCGCGAAAAGATGGCCGACCTGGCGCGCATGGAGGCCGTGCTGTCCGGGCTTGTGTGTGCCTGTCACGCCCGGAAGGGGAATGTTTCCTGCCCGCTGATTGCGTCATTGCAAGACGGAACGAACCTCACCGTATCGGTGCGGGGTGATCACGGGTTGACTACGCCTTAG >>MEG_3885|Metals|Mercury_resistance|Mercury_resistance_regulator|MERR1 ATGAAATTTCGTATCGGAGAACTGGCTGACAAGTGCGGTGTTAACAAGGAGACCATTCGATATTATGAGCGTTTAGGCTTAATTCCAGAGCCTGAACGTACGGAAAAAGGATACCGAATGTATTCCCAACAAACGGTCGATCGATTGCATTTCATAAAACGAATGCAGGAATTAGGATTTACCTTAAATGAAATTGATAAATTGCTAGGGGTTGTCGATCGCGATGAAGCGAAGTGTCGTGATATGTATGATTTCACTATTTTGAAGATAGAGGACATTCAACGTAAAATTGAAGATCTTAAAAGGATTGAACGAATGCTGATGGATCTTAAAGAAAGATGTCCCGAAAACAAAGATATTTACGAATGCCCCATTATTGAAACACTGATGAAGAAATAA >>MEG_3886|Metals|Mercury_resistance|Mercury_resistance_regulator|MERR1 ATGGAAAATAATTTGGAAAACCTGACCATTGGCGTTTTTGCCAAGGCGGCCGGGGTCAACGTGGAGACAATCCGCTTCTATCAGCGCAAGGGCCTGTTGCCGGAACCGGACAAGCCTTACGGCAGCATCCGCCGCTATGGGGAGGCGGACGTGGTTCGGGTGAAATTCGTGAAATCGGCACAGCGGCTGGGGTTCAGTCTGGACGAGATTGCCGAGCTGTTGCGGCTCGACGATGGCACCCACTGCGAGGAGGCCAGCAGCCTGGCCGAGCACAAGCTCCAAGACGTGCGCGAGAAGATGGCCGATTTGGCGCGCATGGAGGCTGTGCTGTCTGACCTGGTGTGCGCCTGCCATTCGCGGCAGGGGAATGTTTCGTGTCCGCTGATTGCGTCGTTGCAAGGTGGAACGAGCTTGGCAGGGGCTTCCACAGCTTAG >>MEG_3887|Metals|Mercury_resistance|Mercury_resistance_regulator|MERR2 ATGGAAAACAATTTGGAGAATCTGACTATCGGCGTATTCGCCAAGGCGGCCGGGGTCAATGTGGAAACCATCCGGTTCTACCAACGCAAGGGCTTGCTGCCTGAGCCGGAGAAGCCCTATGGCGGCATCCGCCGTTACGGTGACGCCGATGTGGCGCGCGTGCGGTTCGTGAAATCAGCCCAGCGGCTGGGCTTCAGCCTGGATGAGATCGCCGAGCTGCTGCGGCTGGAGGATGGCACCCATTGCGAGGAAGCCAGCAGTCTGGCCGAGCACAAGCTCAAGGACGTGCGCGAGAAAATGGCTGACCTGGCGCGCATGGAGGCCGTGCTGTCTGATTTGGTGTGCGCCTGCCATGCGCGGAAGGGGAACGTTTCCTGCCCGCTGATTGCGTCACTGCAAGGGAAGAAAGAACCGCGCAGTGCGGACGCGGTGTAG >>MEG_3888|Metals|Mercury_resistance|Mercury_resistance_regulator|MERR2 ATGGAGGATTTAACGATTGGTCAACTAGCCCAACAAACAGGAGTCAGTCGAAAAGCCATTCGACTGTATGAAGAAAAGGAATTGATACTGCCTTCTATAAAGCGTAGCGAAGGTAATTACCGCGTTTATAACCAAGAGCATGTGTTTTGTATCAATGGTATTAAACAACTCCGATCATTAGGCGTATCACTGGAGGAAATGAAAGATTTAATAGTGATTTTCGAAAAAAATACGGTGGAGATAGAACCGCATCTACAACATTTGTTAAAAGATAAACTGACCAAGATAGACGAACAAATCAACGAACTACAAAAGTTGCGTAAACACATTGAATCGTACCTTGATTCCCCGAAAGAGGCATTCAATCAAATGGAGGGATTTAAACAATGA >>MEG_3889|Metals|Mercury_resistance|Mercury_resistance_regulator|MERR2 ATGGAAAATAATTTGGAGAACCTGACCATTGGCGTTTTTGCCAAGGCAGCCGGCGTCAACGTGGAGACCATCCGGTTCTATCAGCGCAAGGGCTTGTTGCCCGAGCCGGACAAGCCCTATGGCAGCATTCGCCGCTATGGCGCGGCGGACGTGACACGGGTGCGATTCGTGAAATCGGCCCAGCGGTTGGGCTTCAGCCTGGATGAAATCGCCGAGTTGCTGCGGCTCGACGATGGCACCCACTGCGAGGAGGCCAGCAGCCTGGCCGAGCACAAGCTCCAAGACGTGCGCGAGAAGATGGCCGATTTGGCGCGCATGGAGGCTGTGCTGTCTGACCTGGTGTGCGCCTGCCATTCGCGGCAGGGGAATGTTTCGTGTCCGCTGATTGCGTCGTTGCAAGGTGGAACGAGCTTGGCAGGGGCTTCCACAGCTTAG >>MEG_3890|Metals|Mercury_resistance|Mercury_resistance_protein|MERT ATGAAACGTGAGAACAAATTAATTGGTGCAGGTTTACTTGCTGCTATTACAGCTTCATTATGTTGTATTACACCCGTTTTGGCTTTAATCGCTGGAACAAGTGGAATTGCCTCAACATTTTCTTGGCTTGAGCCTTTTAGACCTTATCTAATCGGGCTAACAATTTTAGTGCTCGGCTTTGCTTGGTATCAAAAACTAAAACCTCAAAAAGAAATCGATTGTGAATGCGATACGGACGACCTGCCTGCCGGTAAGGAAGGAAAACCAAAATTTATACAATCAAAAAAGTTTTTAGGAATTGTAACTGTATTTGCAATTATAATGCTGGCATTTCCATATTATTCATTCATTTTTTATCCAGATAATAAAAAAGAAGTAGTCATTGTAAACCAATCAAATATTCAAACTGTAAACTTTAATGTTCAAGGAATGACTTGTGCTGGGTGTGAAGAAAGCATAAAACACGCTGTAAATGAATTGGACGGTATTATAAATGTAACCCCTTCGTATGAAAAGGGAAATGCCATCGTAGAGTTTGATAAGTCTAAAACCTCTAAAGTAGCTATTGAAAAGGCAATTAATTCAACAGGATACAAAGTTATAAAAGATAAATAA >>MEG_3891|Metals|Mercury_resistance|Mercury_resistance_protein|MERT ATGTCTGAACCTCAAAACGGGCGCGGGGCGCTCTTCACTGGCGGGCTAGCCGCCATCCTCGCCTCGGCTTGCTGCCTGGGGCCGCTGGTTCTGATCGCCCTGGGGTTCAGCGGCGCTTGGATCGGCAACTTGACGGTGTTGGAACCTTATCGCCCGATCTTCATCGGCGCGGCGTTGGTGGCGCTGTTTTTCGCCTGGCGGCGCATCTACCGACCGGCGCAAGCCTGCAAACCAGGGGATGTGTGTGCGATTCCCCAAGTGCGCGCTACTTACAAGCTCATTTTCTGGGTCGTGGCCGCGCTGGTTCTGGTCGCGCTCGGATTTCCCTACGTCATGCCATTTTTCTATTAA >>MEG_3892|Metals|Mercury_resistance|Mercury_resistance_protein|MERT ATGTACCTTAACCAAAGAATAAAATTTTTTTTAGAAAGAGTGGTGAGAATGATGGATGAGAATCGCTCGAAAGGTAACCGCTGGGGTGTTTGGGCCTTTTTCGGAATATTATTGGTTCCTTTATTGGTTCCTTTACTTTGTTGCGCAGGACCGATTCTCCTTGTTGCATTAGGGAGCACAGGTATTGGTGCCCTCTTTGCTGGTGCGACAGGAAATTGGTGGTTGACCGGCATTTTTGCAGCATTGGCCATTGTTATGATTGCTCTGATCCTCAGCAAGTTGTTGAAGAACAAATACAATTCTCCTGAAGGCAATGGAAAAACAAAAAATAAAACGGATTGCTGTACGCCTCCAGAGAGCGTGGATCGGAAACATGAGACAAGATAA >>MEG_3893|Metals|Mercury_resistance|Mercury_resistance_protein|MERT ATGTCTGAACCAAAAACCGGGCGCGGCGCGCTCTTCACTGGAGGGCTTGCCGCCATCCTCGCCTCGGCTTGCTGCCTCGGGCCGTTGGTTCTGATCGCCTTGGGGTTCAGCGGCGCTTGGATCGGCAACTTGGCGGTGTTGGAACCCTATCGCCCCATCTTTATCGGCGTGGCGCTGGTGGCGTTGTTCTTCGCCTGGCGGCGCATCTACCGGCAGGCAGCGGCCTGCAAACCGGGTGAGGTCTGCGCGATTCCCCAAGTGCGAGCTACTTACAAGCTCATTTTCTGGATCGTGGCCGCGCTGGTTCTGGTCGCGCTCGGATTTCCCTACGTCATGCCATTTTTCTACTGA >>MEG_3894|Metals|Mercury_resistance|Mercury_resistance_protein|MERT ATGTCTGAACCTCAAAACGGGCGCGGGGCGCTCTTCACTGGAGGGCTAGCCGCCATTCTTGCCTCGGCCTGCTGCCTGGGGCCGCTGGTGCTGATCGCCCTGGGGTTCAGCGGCGCTTGGATCGGCAACTTGACGGTGCTGGAACCCTATCGCCCGATCTTCATCGGCGCAGCGTTGGTGGCGCTGTTCTTCGCCTGGCGGCGCATCTACCGCCCGGCGCAAGCCTGCAAACCGGGTGAGGTCTGCGCGATTCCCCAAGTGCGAACTACTTACAAGTTCATCTTTTGGGGCGTCGCCGCGTTGGTATTGGTCGCGCTCGGATTTCCCTACGTCATGCCATTTTTCTATTAA >>MEG_3895|Metals|Mercury_resistance|Mercury_resistance_protein|MERT ATGAAAGAAAAAGTTTCACAAGTAGCCACTGTATTTTCAGCTTTTGTTATGGCGGGTTGTTGCCTGGGTCCACTAATCTTGATTCCCCTTGGACTCACTGGGTTTGCAGGCGCAATCGCATTCTACTCGTTGAAGTATCGGTTATTGTTCAGCATCGTTACCATTGTCCTTCTTGCGTACTCCTTTTATATGGTTTATGGAAGAAAGGGTAAAAGGAAAAGTTCTGTCATTGGCTTATGGATTACAACGTTCCTTGTTTTTACCATGTTTCTTTTCTTATTTTCAGTTGAAAGTTGA >>MEG_3896|Metals|Mercury_resistance|Mercury_resistance_protein|MERT ATGTCTGAACCACAAAACGGGCGCGGTGCGCTCTTCGCCGGCGGGCTGGCCGCCATTCTTGCATCGACCTGCTGCCTGGGGCCGCTAGTACTGGTCGCCCTGGGCTTCTCCGGTGCTTGGATCGGCAACCTGACGGTGCTGGAACCCTATCGACCGTTGTTCATCGGCGCGGCGCTAGTGGCGCTGTTCTTCGCCTGGAAGCGGATTTACCGGCCCGTGCAGGCATGCAAGCCAGGTGAGGTCTGCGCGATTCCGCAGGTGCGCGCCACCTACAAGCTGATTTTCTGGATCGTGGCCGTGCTGGTCCTGGTCGCGCTTGGATTTCCCTATGTCGTTCCATTTTTCTATTAA >>MEG_3897|Metals|Mercury_resistance|Mercury_resistance_protein|MERT ATGTCTGAACCACAAAACGGGCGCGGCGCGCTCTTCGCCGGTGGGCTGGCCGCCATTCTTGCGTCGGCCTGCTGCCTGGGGCCGCTGGTTTTGATCGCCTTGGGGTTCAGCGGGGCATGGATCGGCAACCTGACGGTGCTGGAACCCTATCGCCCGATCTTCATCGGCGCAGCGCTGGTCGCGCTGTTTTTCGCCTGGCGGCGCATCTACCGCCCGGCGCAAGCCTGCAAACCGGGTGAGGTCTGCGCGATTCCCCAAGTGCGAGCTACTTACAAGCTCATTTTCTGGATCGTGGCCGCGCTGGTCCTGGTCGCGCTCGGATTTCCCTACGTCATGCCATTTTTCTATTAA >>MEG_3898|Metals|Mercury_resistance|Mercury_resistance_protein|MERT ATGTCTGAACCACAAAACGGGCGCGGCGCGCTCTTCGCCGGCGGGCTGGCCGCCATCCTCGCCTCGACCTGCTGCCTCGGGCCGCTGGTCCTGGTCGCCTTGGGATTCAGCGGCGCCTGGATTGGCAACCTGACGGTGCTGGAACCGTATCGCCCGATCTTCATCGGCGCGGCGCTCATCGCGCTGTTCTTCGCCTGGCGGCGCATCTACCGCCCGGCACAAGCCTGCAAACCGGGTGAAGTCTGCGCGATTCCGCAGGTTCGCACAGCCTACAAGCTCGTTTTCTGGATCGTGGCCGCCTTGATCCTGGTTGCCCTCGCTTTTCCCTACGTCCTGCCGCTGTTCTATTGA