MEGAResFrom MEG, the Microbial Ecology Group

Notice: Trying to access array offset on value of type null in /home/meglabuser/megares.meglab.org/vendor/doctrine/annotations/lib/Doctrine/Common/Annotations/DocParser.php on line 967

OLEI

The oleI gene encodes a macrolide glycosyltransferase that inactivates macrolides via transfer of a glucose molecule to the antibiotic.

References

  • http://www.ncbi.nlm.nih.gov/pubmed/9680207

Notice: Trying to access array offset on value of type null in /home/meglabuser/megares.meglab.org/vendor/doctrine/annotations/lib/Doctrine/Common/Annotations/DocParser.php on line 967

Other Groups in Macrolide glycosyltransferases

Sequences

Download Sequences

>>MEG_4278|Drugs|MLS|Macrolide_glycosyltransferases|OLEI
ATGACGAGCGAGCACCGCTCTGCCTCCGTGACACCCCGTCACATCTCCTTCTTCAACATCCCCGGCCACGGCCACGTGAA
CCCGTCACTCGGCATCGTCCAGGAACTGGTCGCGCGCGGCCACCGGGTCAGCTACGCCATCACCGACGAGTTCGCCGCAC
AGGTCAAGGCGGCCGGCGCGACGCCCGTGGTGTACGACTCCATCCTGCCGAAGGAGTCCAACCCCGAGGAGTCGTGGCCG
GAGGACCAGGAGTCCGCGATGGGCCTGTTCCTCGACGAAGCCGTCCGGGTCCTGCCGCAGCTGGAGGACGCCTACGCCGA
CGACCGGCCGGACCTGATCGTCTACGACATCGCCTCCTGGCCCGCCCCGGTGCTCGGCCGGAAGTGGGACATCCCCTTCG
TCCAGCTCTCCCCGACCTTCGTCGCCTACGAGGGCTTCGAGGAGGACGTACCCGCGGTGCAGGACCCCACGGCCGACCGC
GGCGAGGAGGCCGCCGCCCCCGCGGGGACCGGGGACGCCGAGGAGGGTGCCGAGGCCGAGGACGGCCTGGTGCGCTTCTT
CACCCGGCTCTCGGCCTTCCTGGAGGAGCACGGGGTGGACACCCCGGCCACCGAGTTCCTCATCGCGCCCAACCGCTGCA
TCGTCGCGCTGCCGCGCACCTTCCAGATCAAGGGCGACACGGTCGGCGACAACTACACCTTCGTCGGTCCCACCTACGGC
GACCGGTCCCACCAGGGCACCTGGGAAGGCCCCGGGGACGGGCGTCCGGTGCTGCTGATCGCCCTGGGCTCGGCGTTCAC
CGACCACCTCGACTTCTACCGCACCTGCCTGTCCGCCGTCGACGGCCTGGACTGGCACGTGGTGCTCTCCGTGGGCCGCT
TCGTCGACCCCGCGGACCTCGGCGAGGTCCCGCCGAACGTCGAGGTGCACCAGTGGGTGCCGCAGCTCGACATCCTGACC
AAAGCCTCCGCGTTCATCACGCACGCGGGCATGGGCAGCACCATGGAGGCCCTGTCGAACGCGGTGCCCATGGTCGCGGT
GCCGCAGATCGCGGAGCAGACGATGAACGCCGAGCGGATCGTCGAGCTGGGCCTCGGCCGGCACATCCCGCGGGACCAGG
TCACGGCCGAGAAGCTGCGCGAGGCCGTGCTCGCCGTCGCCTCCGACCCCGGTGTCGCCGAACGGCTCGCGGCCGTCCGG
CAGGAGATCCGTGAGGCGGGCGGCGCCCGGGCGGCCGCCGACATCCTGGAGGGCATCCTCGCCGAAGCAGGCTGA