MEGAResFrom MEG, the Microbial Ecology Group

Notice: Trying to access array offset on value of type null in /home/meglabuser/megares.meglab.org/vendor/doctrine/annotations/lib/Doctrine/Common/Annotations/DocParser.php on line 967

OLEC

The oleC gene encodes an ABC efflux pump that has been shown to function on MLS compounds.

References


    Notice: Trying to access array offset on value of type null in /home/meglabuser/megares.meglab.org/vendor/doctrine/annotations/lib/Doctrine/Common/Annotations/DocParser.php on line 967

    Other Groups in MLS resistance ABC efflux pumps

    Sequences

    Download Sequences

    >>MEG_4276|Drugs|MLS|MLS_resistance_ABC_efflux_pumps|OLEC
    GTGACCGTACGGGGGCTGGTCAAGCACTACGGCGAGACCAAGGCGCTGGACGGCGTCGACCTGGACGTGCGCGAGGGCAC
    CGTGATGGGTGTGCTCGGGCCGAACGGCGCCGGCAAGACCACCCTCGTCCGCATCCTGTCCACCCTGATCACCCCGGACT
    CCGGGCAGGCCACCGTGGCCGGCTACGACGTCGTACGCCAGCCCCGGCAGCTGCGCCGGGTCATCGGGCTCACCGGCCAG
    TACGCGTCGGTGGACGAGAAGCTCCCGGGCTGGGAGAACCTCTACCTGATCGGCCGGCTGCTGGACCTGTCCCGCAAGGA
    GGCCCGGGCCCGCGCCGACGAGCTGCTGGAGCGGTTCTCGCTGACCGAGGCCGCCCGGCGCCCGGCCGGCACCTACTCCG
    GCGGTATGCGGCGCCGACTGGACCTGGCCGCCTCGATGATCGGCCGGCCGGCCGTGCTGTACCTGGACGAGCCGACCACC
    GGCCTCGACCCGCGCACCCGCAACGAGGTGTGGGACGAGGTCAAGGCGATGGTCGGCGACGGCGTCACCGTGCTGCTCAC
    CACCCAGTACATGGAGGAGGCCGAGCAGCTCGCCTCGGAACTGACCGTGGTGGACCGCGGCCGGGTCATCGCCAAGGGCG
    GCATCGAGGAGCTGAAGGCCCGCGTCGGCGGGCGCACCCTGCGGGTGCGGCCGGTCGACCCGCTCCAGCTGCGCCCGCTC
    GCCGGCATGCTGGACGAGCTGGGCATCACCGGGCTGGCTTCCACCACCGTGGACACCGAGACCGGGGCCCTGCTGGTGCC
    GATCCTCAGCGACGAGCAGCTGACCGCCGTGGTCGGCGCGGTCACCGCGCGCGGCATCACGCTGTCCTCCATCACCACCG
    AACTGCCCAGCCTGGACGAGGTGTTCCTGTCCCTCACCGGCCACCGCGCCAGTGCCCCGCAGGACGCCGAGCCCGCCCGC
    CAGGAGGTCGCCGTATGA