MEGAResFrom MEG, the Microbial Ecology Group

Notice: Trying to access array offset on value of type null in /home/meglabuser/megares.meglab.org/vendor/doctrine/annotations/lib/Doctrine/Common/Annotations/DocParser.php on line 967

OLEB

The oleB gene encodes an ABC efflux pump that has been shown to function on MLS compounds.

References

  • http://www.ncbi.nlm.nih.gov/pmc/articles/PMC2752038/,http://www.ncbi.nlm.nih.gov/pubmed/7565095

Notice: Trying to access array offset on value of type null in /home/meglabuser/megares.meglab.org/vendor/doctrine/annotations/lib/Doctrine/Common/Annotations/DocParser.php on line 967

Other Groups in MLS resistance ABC efflux pumps

Sequences

Download Sequences

>>MEG_4275|Drugs|MLS|MLS_resistance_ABC_efflux_pumps|OLEB
ATGCAGAACGCACACCGTTCCGATACCGGCGCCGCGGCGCTCACCGGCACGCCGGAAAAGCTCCTTCCCACGCAACCTGA
GACCGGTTCCTTCCAGGTCGTCCTCGACGACGTCGTCCGGGCACCCGGCGGACGGCCGCTGTTGGACGGCGTCAACCAGT
CGGTGGCACTCGGCGAGCGCGTCGGCATCATCGGTGAGAACGGATCGGGCAAGTCGACCCTGCTCCGCATGCTCGCCGGC
GTGGACCGCCCGGACGGTGGCCAGGTCCTCGTCCGGGCTCCCGGCGGCTGCGGCTACCTCCCCCAGACACCGGACCTGCC
CCCGGAGGACACCGTTCAGGACGCCATCGACCACGCCCTCGCCGAACTGCGCTCCCTGGAGCGGGGGTTGCGTGAGGCGG
AGCAGGCGCTGGCCGGGGCGGAGCCCGAGGAGCTGGAGGGCCTGCTCGGCGCCTACGGCGACCTGCTGGAGGCGTTCGAG
GCCCGCGACGGCTACGCGGCGGACGCCCGTGTCGACGCGGCGATGCACGGCCTCGGTCTGGCGGGCATCACGGGCGACCG
GCGGCTCGGCAGCCTCTCCGGAGGTGAGCAGGCGCGTCTCAACCTGGCCTGCCTGCTGGCCGCGTCCCCGCAGCTGATGC
TGCTCGACGAACCCACCAACCACCTCGACGTCGGGGCGCTGGAGTGGCTGGAGGAGCGCCTGCGGGCCCACCGCGGCAGC
GTGCTGGTCGTCTCGCACGACCGGGTCTTCCTGGAGCGCGTGGCCACCGCCCTGTGGGAGGTGGACGGCGAGCGGCGCAC
CGTCAACCGGCACGGCGGCGGTTACGCGGGATACCTGCAAGCCAAGGCGGCCGCGCGGCGCCGCTGGGAGCAGGCTTACC
AGGACTGGCTGGAGGACCTGGCACGCCAGCGGGAACTGGCCCGCAGCGCCGCCGACCACCTGGCCACCGGCCCGCGGCGC
AACACCGAGCGGTCGAACCAGCGCCACCAGCGCAACGTGGAGAAGCAGATCTCCGCGCGGGTCCGCAACGCCAAGGAGCG
GGTCCGCCGGCTGGAGGAGAACCCGGTGCCGCGGCCCCCTCAACCCATGCGTTTCCGGGCCCGGGTGGAGGGTGGCGGCA
CGGTCGGGCGCGGCGGGGCACTCGCCGAGCTGTACAAGGTCACCGTCGGCACGCGGCTCGACGTCCCGTCCTTCACCGTC
GACCCCGGTGAGCGCATCCTGATCACGGGGCACAACGGCGCGGGCAAGAGCACCCTGCTGCGCGTGCTGGCCGGTGACCT
GGCGCCCGATCAGGGCGAGTGCGAGCGCCCGGAGCGCATCGGCTGGCTGCCGCAGGAGACGGAGATCACCGACCGGCAGC
AGAGCCTGCTGGCGGCCTTCGCGGCGGGGCTGCCCGGCATCGCGGAGGAACACCGGGGCGCGCTCCTGGGATTCGGGCTC
TTCCGGCCCTCGGCGCTGGGCACCGCGGTGGGAGACCTGTCCACCGGGCAGTTGAGGCGGCTGGCCCTGGCCCGTCTGCT
GCGCGACCCGGCGGACCTGCTGCTGCTCGACGAGCCGACGAACCACCTGTCGCCCGCGCTCGTGGAGGACCTGGAGGAGG
CGCTGGCGCACTACCGGGGCGCACTGGTCGTGGTCTCCCACGACCGCATGTTCGCGCAGCGGTTCACCGGTCGCCGCATG
CACATGGAGGGTGGCCGCTTCGTGGAGTGA