MEGAResFrom MEG, the Microbial Ecology Group

Notice: Trying to access array offset on value of type null in /home/meglabuser/megares.meglab.org/vendor/doctrine/annotations/lib/Doctrine/Common/Annotations/DocParser.php on line 967

VANTN

The vanT gene encodes a serine/alanine racemase. This gene is part of the VanN operon and is a core resistance gene.

References

  • http://cid.oxfordjournals.org/content/42/Supplement_1/S25.full,http://www.readcube.com/articles/10.1038/ja.2013.117

Notice: Trying to access array offset on value of type null in /home/meglabuser/megares.meglab.org/vendor/doctrine/annotations/lib/Doctrine/Common/Annotations/DocParser.php on line 967

Other Groups in VanN-type resistance protein

Sequences

Download Sequences

>>MEG_7534|Drugs|Glycopeptides|VanN-type_resistance_protein|VANTN
ATGAAAAACGTAAATACCGGGATCAATCAATTTCGATTGATCGCTGCTTTCATGGTCGTTGCGATTCACTGTTTTCCTTT
TCAGTCGTTTAGTAAAACTCTTGATATATTGATTACTTTGACACTCTTTCGAACTGCCGTACCTTTTTTCTTAATGGTCA
CAGGTTTTTATTTAATTGGACCGATTGCCACTAAGAGAGGCTATCCAGCCTATTTAAAGATAAAAAAATTTTTAAAAAAG
CAAGTGAAGCTATATGTGCTTGCTACGCTCATTTATCTTCCACTAGCTTTTTATAGTGGTGTGATCACTTTCAAGACGAG
TGTCATTCAATTTTTTCAACTCATCTTTTTCGAAGGAGTTCTTTACCACTTGTGGTATTTTCCAGCATTGATTTTAGGTG
TTCTCATCGTTTACTGCTTATTACAGCGGTTCACGCTTCGACAAGTTTTATTAGTGACTTTTCTATTCTATTTACTATGT
TTGGGCGGCGATAGCTGGTGGGGGTTAGCTAGACAAATTCCTGTGTTAGAAAAAAGTTATCAAGGGATATTTACGCTCAT
GATCCATACTCGAAATGGACTATTTTTTGCCCCTTTCTTTTTAACACTCGGTGCTTCGTTCCATCAATCAGAGTGGAACA
TGCGTACATCTAAAGCCAAGTATTTTTTGTTGATTGCTAGTTTAGGCATGCTAGTGGAAAGCTATTTGCTACACTCCTTT
AGTTCACCAAAACATGATAGTGCATACCTATTCTTGCCTGTGGTGATGTTTTTTCTTTTTCCACTTATTTTGAACTGGCA
GCCTACACGTGTCATTGCCGACGCTTCGACAATCAGTTTAGGTATTTATGTCCTTCATCCTTATGTCATTGCTGTTGTCC
ATACTTTAGCCAAAAAAATAACGATACTAAACAATAGTTTAATTTATTATCTCTGCGTTTCCCTTTTAACTAGTTTGATT
ATTCTTTATGTACACTCTAAGAAAAAGAAAACGACAAAAAATCAGGCTACGTTTGTCCCTAGAACAAAAAAAGTACTCTC
TAAGCAAGCAGTTATCCATAATTTGGCACAAATCAATCAAGTGATTCCGAAAACAACGAAAATAATGGCTGTCATAAAAG
CCAACGCTTATGGAACTGATGATACAGAATTTGCTCGAATCTTAGAACAACAAGGAGTTGATTTTTTTGCTGTCGCTACC
ATTGATGAAGGCATTCGTTTGCGAGAAAATGGAATTAAAAGCAAAATCTTAATTCTAGGCTATACACCATCGATACGAAT
AAAAGAATTAGCTCACTACACATTAATACAAACAATCGTTAGCAAAGAACATGCTTATTCATTAAATCAACAAAAGATAC
CTATTTCGTGCCATCTAAAAATTGATACTGGCATGCATCGTTTAGGTGTTGAGCCTGTGGTTCAGGAGGTTTCATCCTTA
TATCGATTACCCTACTTAAATATTCAAGGTATTTATTCTCATCTCGGTTCAGCTGATGATCGAAGTGACAAAGGAATGAA
ACGCACGAGAAAACAAATTTCGATTTTTGATTATTTATTACATGAACTAGAACTTCAAAAAATCGATGTCGGTGTTACGC
ATCTGCAAAGTAGCTATGGTATTTTGAATTATCCTGAACTGGTCTATGATTATGTTCGTCCTGGTATTCTTTTATACGGT
TATTTAAGTGAACATAATGGAGATTCAAAAATCAACTTAAATTTGCAACCAATTTTAGATGTCCAAGCACTGCTCGTATC
AAAAAAATGGGTTGCTGCTGGTGAATATCTTGGCTATAGCCTTGATACTAAACTAGTTTCTCCAAAGCTGATTGGTATCG
TCAGCATCGGCTATGCAGACGGTGTTCCTAGAGAGTTATCTCACAATGAGTTTTATCTTGCTTATCAGGGACAAAATCTA
CCACAAATCGGACGAATTTGTATGGATATGCTATTAGTGGATTTGACTGATTCTCCAGAAATCAAAGTAGAGTCACAAAT
TAGTATCTTCCCAGAACTAGAACAAACTGCTAATCAAACGAATACATTGACTAACGAAATCATCAGTCGCTTAGGTAATC
GTTTCTACACCGAATGGTCCTAA

>>MEG_7535|Drugs|Glycopeptides|VanN-type_resistance_protein|VANTN
ATGAAAAACGTAAATACCGGGATCAATCAATTTCGATTGATCGCTGCTTTCATGGTCGTTGCGATTCACTGTTTTCCTTT
TCAGTCGTTTAGTAAAACTCTTGATATATTGATTACTTTGACACTCTTTCGAACTGCCGTACCTTTTTTCTTAATGGTCA
CAGGTTTTTATTTAATTGGACCGATTGCCACTAAGAGAGGCTATCCAGCCTATTTAAAGATAAAAAAATTTTTAAAAAAG
CAAGTGAAGCTATATGTGCTTGCTACGCTCATTTATCTTCCACTAGCTTTTTATAGTGGTGTGATCACTTTCAAGACGAG
TGTCATTCAATTTTTTCAACTCATCTTTTTCGAAGGAGTTCTTTACCACTTGTGGTATTTTCCAGCATTGATTTTAGGTG
TTCTCATCGTTTACTGCTTATTACAGCGGTTCACGCTTCGACAAGTTTTATTAGTGACTTTTCTATTCTATTTACTATGT
TTGGGCGGCGATAGCTGGTGGGGGTTAGCTAGACAAATTCCTGTGTTAGAAAAAAGTTATCAAGGGATATTTACGCTCAT
GATCCATACTCGAAATGGACTATTTTTTGCCCCTTTCTTTTTAACACTCGGTGCTTCGTTCCATCAATCAGAGTGGAACA
TGCGTACATCTAAAGCCAAGTATTTTTTGTTGATTGCTAGTTTAGGCATGCTAGTGGAAAGCTATTTGCTACACTCCTTT
AGTTCACCAAAACATGATAGTGCATACCTATTCTTGCCTGTGGTGATGTTTTTTCTTTTTCCACTTATTTTGAACTGGCA
GCCTACACGTGTCATTGCCGACGCTTCGACAATCAGTTTAGGTATTTATGTCCTTCATCCTTATGTCATTGCTGTTGTCC
ATACTTTAGCCAAAAAAATAACGATACTAAACAATAGTTTAATTTATTATCTCTGCGTTTCCCTTTTAACTAGTTTGATT
ATTCTTTATGTACACTCTAAGAAAAAGAAAACGACAAAAAATCAGGCTACGTTTGTCCCTAGAACAAAAAAAGTACTCTC
TAAGCAAGCAGTTATCCATAATTTGGCACAAATCAATCAAGTGATTCCGAAAACAACGAAAATAATGGCTGTCATAAAAG
CCAACGCTTATGGAACTGATGATACAGAATTTGCTCGAATCTTAGAACAACAAGGAGTTGATTTTTTTGCTGTCGCTACC
ATTGATGAAGGCATTCGTTTGCGAGAAAATGGAATTAAAAGCAAAATCTTAATTCTAGGCTATACACCATCGATACGAAT
AAAAGAATTAGCTCACTACACATTAATACAAACAATCGTTAGCAAAGAACATGCTTATTCATTAAATCAACAAAAGATAC
CTATTTCGTGCCATCTAAAAATTGATACTGGCATGCATCGTTTAGGTGTTGAGCCTGTGGTTCAGGAGGTTTCATCCTTA
TATCGATTACCCTACTTAAATATTCAAGGTATTTATTCTCATCTCGGTTCAGCTGATGATCGAAGTGACAAAGGAATGAA
ACGCACGAGAAAACAAATTTCGATTTTTGATTATTTATTACATGAACTAGAACTTCAAAAAATCGATGTCGGTGTTACGC
ATCTGCAAAGTAGCTATGGTATTTTGAATTATCCTGAACTGGTCTATGATTATGTTCGTCCTGGTATTCTTTTATACGGT
TATTTAAGTGAACATAATGGAGATTCAAAAATCAACTTAAATTTGCAACCAATTTTAGATGTCCAAGCACTGCTCGTATC
AAAAAAATGGGTTGCTGCTGGTGAATATCTTGGCTATAGCCTTGATACTAAACTAGTTTCTCCAAAGCTGATTGGTATCG
TCAGCATCGGCTATGCAGACGGTGTTCCTAGAGAGTTATCTCACAATGAGTTTTTATCTTGCTTATCAGGGACAAAATCT
ACCACAAATCGGACGAATTTGTATGGATATGCTATTAGTGGATTTGACTGA