MEGAResFrom MEG, the Microbial Ecology Group

Notice: Trying to access array offset on value of type null in /home/meglabuser/megares.meglab.org/vendor/doctrine/annotations/lib/Doctrine/Common/Annotations/DocParser.php on line 967

VANSM

The vanS gene encodes a sensory His-kinase and is part of the two-component sensor-kinase system. This gene is part of the VanM operon and is a regulator gene.

References

  • http://cid.oxfordjournals.org/content/42/Supplement_1/S25.full,http://www.readcube.com/articles/10.1038/ja.2013.117

Notice: Trying to access array offset on value of type null in /home/meglabuser/megares.meglab.org/vendor/doctrine/annotations/lib/Doctrine/Common/Annotations/DocParser.php on line 967

Sequences

Download Sequences

>>MEG_7515|Drugs|Glycopeptides|VanM-type_regulator|VANSM
ATGGCTAAAATGAGAAGCAGTTTTCGCACCAAAATCATCTTGTTATTTGCTGTAAGCATGCTTCTGGCTGGTATGGTAAC
TTACTTACTTTTTAAAGGACTACAGCTTTATTATCATACTATGATTCATCGTGGTAACCCATTAGCCGAACTTCGCGATT
TCATAGAGAGTATTGGAGACTTTAACTTCTTTTTCCTATTATTTATCTTACTGTCGCTGTCGGTTTTCTATATACTCACT
AAGCCCTATTCTGCTTATTTCGATGAAATATCAACCGGAATTCAATACCTCGCACTTGGCGACTTTAAACGCCGGGTTAA
TATCCAATCAAATGATGAATTTGGGGATATTGCTCAAGCTATTAATCAGGCAAGTGAAAAATTAGAAGAAGCCATACAAA
GAGGTGATTTTTCAGAAAACAGCAAAGAACAATTAGTTGTAAATTTGGCTCATGATTTGCGTACGCCGCTAACTTCTGTT
TTAGGTTATTTAGATTTAGTTCTTAAGGATGAGAAGTTGACAAAAGAACAAGTCAGGCATTTTTTAACGATCGCCTTTAC
GAAATCACAGCGTTTAGAAAAACTGATTGATGAATTATTCGAAATCACGAGAATGAACTATGGCATGCTATCAATTGAAA
AAAAGCCAATTAATTTAACTGATCTGCTTCTTCAATTGAAAGAAGAATTGTATCCGATTTTCGAGAAAAACGGTTTGACC
GCTCGAATGAATACACTGCCTCATTTACCTGTTTCGGCTGATGGAGAGATGTTGGCTCGAGTGTTTGAAAATCTGTTGAC
CAATGCCAATCGTTACGGACATGACGGTCAGTTTGTAGATATTAATGGGTTTGTTGATGAAGAAGAAGTGGTTGTTCAAG
TTGTGAATTATGGAGATAGCATTCCTCCGAACGAACTTCCGTATCTTTTTGATATGTTCTATACCGGTGATAAAGCACGA
ACCCATAAAGAGGATAGCACTGGTCTTGGACTATTTATTGCGAAGAATATTGTGGAACAGCATAATGGAACGGTTACGGC
TGAAAGCAGTCTAATACGTACGGTATTTGAAGTTCGTTTACCGCTGGAAAGTGCTCCTATTGACCAAGTTTAA

>>MEG_7516|Drugs|Glycopeptides|VanM-type_regulator|VANSM
ATGGTCTTTCAAGGAAACTTACTCTTGGTTAATAACGAATATCCGGTTCTCGAAGAGAGTATAAAAACAGACGTTGTAAA
TTTATTTAAACATGATGAATTGACAAAAGGATATGAATTGCTCAATAGGGAAATTTATTTATCGGAGAAAGTTGCCCGTG
AATTTTCAGAGATGGTAGATGCGGCTGAAAAAGAAGGAGTTCGCCATTTTTCAATCAATAGTGGGTTTCGAAACTTTGAT
GAGCAAAATGCCCTTTATCAAGAAATGGGGTCTGACTACGCCTTGCCTGCAGGTTATAGCGAACATAATTTAGGTTTAGC
ACTTGATATCGGATCTACTCAAATGGAAATGAGTGAGGCACCGGAAGGAAAGTGGCTAGAAGATAATGCGTGGGAATACG
GCTTTATTTTACGCTATCCAATGGACAAAACGGCCATCACAGGTATTCAGTATGAACCTTGGCATTTTCGCTATGTGGGA
TTACCGCACAGTGCAATTATAGAGGAAAAGAATTTTGCTTTAGAAGAATATTTGGATTTCCTAAAAGAACAAAAATCCAT
TTCAGGTACTATACATGGCGAAAATTATGAGATTTCTTATTATCCTATTACCGAAAAAACAGACATTGAAATGCCTGCCA
ATCTTCATTATGAAATATCAGGAAACAATATGGATGGTGTGATTGTGACAGTGTATCGCTAA

>>MEG_7517|Drugs|Glycopeptides|VanM-type_regulator|VANSM
ATGGTCTTAGTAATGAAAGATATCGGCATTACCATTTATGGATCTGAGCAGGATGAGGCTGATGTGTTCCAGGAAATTTC
ATCTCGATTTGGCGTTACACCTACCATTGTAAGCTCTCCTATATCAGAAACCAACGTAATGTTAGCCCCTAAAAATAAGT
GTATCAGCGTGGGGCACAAGTCTGAGATTCACAAATCTATCCTTATTGCATTGAAGGAATCCGGCGTCAAATATATCTCT
ACTCGAAGTATTGGTTACAATCATATAGATATGAAGGCAGCGGAAAAAATGGGTATTGCTGTCGAGAACGTCACTTATTC
ACCAGATAGTGTTGCCGATTATACATTGATGCTGATACTTATGGCAATACGCCATACGAAATCTACTTTGTGCTCTATGG
AAAAACATGATTTCAGACTGAACAGCGTCCGTGGTAAAGTACTGCGTGACCTGACAGTAGGTGTACTGGGAACCGGTCAT
ATAGGCAAAGCGGTTATTGAGCGACTACAGGGGTTTGGAGGTCACGTGTTGGCGTACGGCAACAACAAAGAGGCGACGGC
AAATTATGTATCCTTCAATGAATTACTGCAAAAAAGTGACATTCTAACCATTCATGTACCCCTTAGCGATGACACATACC
ATATGATCGGTCACGAACAGATTAAAGCAATGAAACAGGGCGCCTTTCTTATTAATACTGCTCGAGGTGGACTTATAGAT
ACCGAAGTTCTGGTTAAAGCACTGGAGGACGGAAAACTGGGGGGCGCCGCATTAGATGTATTAGAGGGAGAAGAAGGGCT
TTTCTACTTTGATTGCACCCAAAAGCCAATTAACAATCAATTTTTGCTGAAACTTCAAAGGATGCCAAATGTGACAATCA
CACCGCATACGGCTTACTATAGCGAAAAAACGTTACGTGATACTGTTGAAAAAACAGTCAAGAACTGTTTGGAATTTGAG
AGGAGAGAGACACATGAATAG

>>MEG_7518|Drugs|Glycopeptides|VanM-type_regulator|VANSM
ATGAATAGATTGAAAATAGCCATCCTGTTTGGGGGTTGCTCAGAAGAGCATAATGTATCGGTAAAATCAGCGGCAGAGAT
TGCCAACAACATTGATATAGGAAAATATGAACCAATATACATCGGAATAACCCAATCTGGCGTTTGGAAAACATGCGAAA
AACCATGTATAGATTGGGATAATGAACACTGTCGCTCGGCAGTACTTTCTCCGGATAAAAAAATGCATGGGTTGCTTATT
ATGCAAGATAAAGGATATCAAATACAGCGTATAGATGTAGTCTTTTCAGTGTTGCACGGAAAATCGGGTGAAGACGGCGC
CATACAAGGATTATTTGAATTGTCTGGTATACCTTATGTAGGCTGTGATATTCAAAGTTCGGCGGTTTGTATGGACAAAT
CACTGGCATATATTATTGCGAAAAACGCTGGCATAGCTACTCCTGAATTTCAGGTCATTTATAAAGACGATAAGCCAGCG
GCAGATTCGTTTACCTATCCCGTTTTTGTTAAGCCAGCACGTTCAGGTTCCTCCTATGGTGTGAATAAAGTTAATAGTGC
GGATGAATTGGACTCCGCAATTGACTTGGCAAGACAATATGACAGCAAAATCCTAATTGAGCAGGGTGTTTTAGGTTATG
AGGTCGGTTGTGCCGTATTGGGAAACAGTTTCGACTTGATTGTTGGTGAAGTGGATCAAATCAGACTGCAACACGGTATT
TTTCGTATTCATCAGGAAGCCGAGCCGGAAAAAGGTTCTGAAAACGCAACTATAACCGTTCCCGCAGAACTATCGGCAGA
GGAGCGAGAACGGATAAAAGAAGCGGCAAAAAATATATATAAGGCGCTCGGGTGTAGAGGTCTTTCTCGTGTTGATATGT
TTTTACAAGATAACGGCCGCATTGTACTAAATGAAGTCAATACCATGCCTGGTTTCACGTCATACAGCCGTTATCCACGT
ATGATGGTCTCAGCAGGTATAACAATTCCCGAACTGATTGACCATCTGATTGTATTAGCTGTAAAGGAGTGA

>>MEG_7519|Drugs|Glycopeptides|VanM-type_regulator|VANSM
ATGGAAAAAGGATTTACCTTTTTAGATGAAATATTAAACGATGTTCGTTGGGACGCTAAATATGCTACGTGGGACAACTT
CACTGGAAAACCAATTGATGGATATGAAGTAAATCGAATTATAGGAACATATGAGTTAGCCGATGCGCTATTGAAGGTTC
AAGAATTAGCTTTTAACCAAGGTTATGGATTGCTTTTATGGGACGGTTACCGTCCCCAACAAGCTGTAAATTGTTTTTTG
CAATGGGCGGCACAGCCGGAAGATAATCGAACAAAGGCAAAATATTATCCCAATATTGACCGAACTGAGATGGTTTCAAA
AGGATACGTGGCTTCAAAATCAAGTCATAGCCGCGGAAGTGCAATTGATCTTACACTTTATCGATTAGACACGGACGAAC
TTGTTCCGATGGGGAGCGGATTTGATTTTATGGATGAGCGCTCTCATCATGAGGCAAAAGGAATTACGAGCAATGAAGCG
CAAAACCGTAGATTTTTGCGTTCCATTATGGAAAACAGTGGGTTTGAAGCGTATAGTTTCGAATGGTGGCACTATGTATT
GATAAACGAACCTTATCCCTATAGCTGCTTTGATTTTCCTGTCAAATAA

>>MEG_7520|Drugs|Glycopeptides|VanM-type_regulator|VANSM
ATGAGACGTATATCGATTTTAATTGCTGAAGATGAAGAAGAAATTGCTGATTTGCTTGCCATTCACCTGGAAAAAGAAGG
ATATGACGTTATTAAAGTACATGACGGACAAGAAGCCCTCCATGTAATCCAGGCTCAATCAATTGATTTGATAATTTTAG
ATATTATGATGCCGAAAATGGATGGATATGAAGTAACCCGTCAAGTCCGTGCACAGTATAATATGCCAATCATTTTTTTA
AGTGCGAAAACTTCTGATTTCGATAAGGTGCATGGTCTAGTGATTGGAGGGGATGATTATATAACAAAGCCATTTACCCC
GATTGAATTGGTTGCTCGTGTGAACGCTCAATTGCGGCGCTCTATGAAGTTGAATCACCCCCAAGCAGATGATAAAAAAT
CTATCTTGGAGTTCGGTGAGATCGTGATTTCTCCTGATCAACGTACAGTTTTTCTTTATGGTGAAAACATCGGGTTAACG
CCGAAAGAGTTTGATATTTTGTATTTATTAGCCAGTCATCCAAAGAAAGTTTATAGTGTCGAAAATATTTTCCAGCAAGT
TTGGAATGATGCATACTTTGGAGGCGGTAATACGGTAATGGTGCATATTCGCACCTTGCGGAAAAAACTTGGAGAAGATA
AGCGAAAAAATAAGTTAATCAAAACTGTGTGGGGAGTGGGGTATACGTTCAATGGCTAA