MEGAResFrom MEG, the Microbial Ecology Group

Notice: Trying to access array offset on value of type null in /home/meglabuser/megares.meglab.org/vendor/doctrine/annotations/lib/Doctrine/Common/Annotations/DocParser.php on line 967

VANI

The vanG gene encodes a D-ala-D-lac ligase. This gene is part of the VanI operon and is a core resistance gene.

References

  • http://cid.oxfordjournals.org/content/42/Supplement_1/S25.full,http://www.readcube.com/articles/10.1038/ja.2013.117

Notice: Trying to access array offset on value of type null in /home/meglabuser/megares.meglab.org/vendor/doctrine/annotations/lib/Doctrine/Common/Annotations/DocParser.php on line 967

Other Groups in VanI-type resistance protein

Sequences

Download Sequences

>>MEG_7439|Drugs|Glycopeptides|VanI-type_resistance_protein|VANI
atgaataagttaaaaatcgccatcatcttcggaggctgttctgaagaacatcctgtctccgttaaatcagctcaagaggt
cgccgacaatctggatcttgaaaagtatgaacccttctatatcgggattacgaaaagtggggtttggaagctttgtcacc
gccctgaggcaaattgggaaaagggtagctgcctgccggcgatcctgtcaccggacagaagcgtgcagggattgctggtt
ctggagcatggacattacaaaaccatccctttggatatggtgtttcccgttctgcatggcaaattcggtgaggatggtgc
gatgcagggtttgctggagctttccggcatcccttatgcaggctgcgatgttccaagttccgccctgtgtatggacaaag
ccctggcctatatcgttgcgggaagcgcaggaattgcgacgccaaatttccggacggtcacagcggaggaggatatcgat
gccgatgggcttgcttatcccgtttttgtcaaaccggcccgttcgggttcatcctttggcgtcactaaagtatgccgcaa
agaagacttgctgagtgcggtggccagcgccagagagtatgacacgaaggtgttgattgaagaagctgtcgccggcagtg
aggtaggatgcgcgatatttggaaatgatccggatttggtggcaggggaggtggatcagatttgcctgtcccatggtttt
ttcaaaatccatcaggaggatgagccggaaaagggttccgaaaactcaaagctgatcgttccctccgacattccggcgga
ggcgcgcctgcaggttcaggagacggccaaagccatctaccgcgccttgggatgcagggggctggcccgggtggatatgt
tcctgaaggaagatggagaagtcatcctgaacgaggtgaataccttgcccggcatgacctcctacagccgttttccgaaa
atggtggcggctgcagggctgccctttgccgaagtgctcgaccggattatctcattggccttgaaaggaaaaagatga

>>MEG_7440|Drugs|Glycopeptides|VanI-type_resistance_protein|VANI
atgaatcgattgaaaatcgccattatcttcggaggttgttctgaagaacattccgtttccgttaaatctgcccaagaggt
cgctaaaaaccttgatctcgaaaagtatgagccctactatatcggaattacgcaaaatggtgtctggaagctttgtcact
tccctgaagcaaattgggaaaatagttgttgtcttccggctatgctggcaccggacagtggggtacacggcttgattgtt
ttggagcagggaaaatacaagatgatacctttggatatggtgtttcctgttctgcatggcaaatttggcgaggatggtgc
catacaaggtttgttggagctttcctgcatcccatatgtaggctgcgatatccaaagttctgctctgtctatggacaaat
cccttgcttatatcgtcgccggaaacgcgagaattgcgaccccgaatttctggacgtttacggagaacgaggatatggac
cccgaccggtttatttaccccgtttttgttaagccggcccgttcggggtcatcttttggggttactaaggtatgccgaga
agaagaattgctaagtgcggtggaaatcgccagacagtatgattcgaaggtgctgattgaagaggctgtcgtcggtagtg
aggtaggatgtgcgatatttggggacgatccggatttgactgcaggagaagtagatcaaatttcactatcgcatggtttt
tttagaatccatcaggagagtgagcctgaaaacggttccgaaaactcaacaatcatcgttcccgctgatatttcgacgga
gatgcgcttgcatatccaggagacggctaaagccatctatcgtgctttgggatgcaggggactggcgcgagtggatatgt
ttctgaaggaagatggggaagtaattctaaacgaggtaaatacgttgcctggaatgacctcgtacagccgttttccgaga
atgatggcagccgcagggctaacttttgccgaagtgatcgaccgaatcgttgcattaaccttggaagggaaaagacgatg
a

>>MEG_7441|Drugs|Glycopeptides|VanI-type_resistance_protein|VANI
atgagtaagttgaaaatcgcaattatcttcggaggctgttccgaagaacatcccgtctccgttaaatctgctggggaggt
ggccaaaaacctggatctcgaaaagtatgaacccttctatatcgggattacgaaagatggggtttggcagctttgtcact
accctgaggccaattgggaaaagggcagttgccgtccggctatcctgtcaccggacagaagcgtccagggattgcttgtt
ctggagcaggggcaataccaaaggatccccttggatctggtgtttcccgttctgcatggcaaatttggcgaggatggcgc
gatacagggtttgttggagctttccggcatcccctatgtgggctgcgatatcccgagttcggctctgtgcatggacaaat
ccctggcttatatcgtcgctggaaaggcaggaattgccacgccaaagttccggacggtcactgcgaaggagactattgac
gccgaacggcttgcttatcccgtttatgtcaagccggcccgttcgggttcatccttcggcgtcactaaggtatgccgcca
agaagaattgctgagtgcggtggaaatcgccagacagtatgactcgaaggtgctgattgaagaggctgtcgtcggcagcg
aggtaggctgtgcgatatttggaaacgatctggatttgatggccggtgaggtcgatcagatctgtctgtctcatggcttt
ttcagaatccatcaggagaatgagccggaaaagggttccgaaaactcaacactaatcgttcccgccgacatttccccaga
ggcgcgctcgcgggttcaggagacggcaaaagccatctatcgcgctttgggctgcaggggactggcgcgggtggatatgt
ttctgaaagaagatggaacagtaatcctcaacgaggtgaatactttgcccggcatgacctcatacagccgttttccgaga
atgatggcggccgcaggcttgccctttgccgaagtgatcgaccggcttgtctcgttggccttttaa

>>MEG_7442|Drugs|Glycopeptides|VanI-type_resistance_protein|VANI
ATGACTAAGTTGAAAATTGCAATTATCTTCGGAGGCTGTTCCGAAGAACATCCCGTCTCCGTTAAATCTGCTGGGGAGGT
CGCCAAAAACCTGGATCCCGAAAAGTATGAACCCTTCTATATCGGGATTACGAAAGATGGGGTTTGGCAGCTTTGCCACT
ACCCTGAGGTCAATTGGGAAAAGGGCAGCTGCCGTCCGGCTATCCTGTCACCGGACAGAAGCGTCCAGGGATTGCTTGTT
CTGGAGCAGGGACAATACCAAAGGATACCTTTGGATCTGGTGTTTCCCGTTCTGCATGGCAAATTTGGCGAGGATGGGGC
GATGCAAGGCTTGCTGGAGCTTTCCGGCATCCCCTATGTGGGCTGTGATATCCCGAGTTCGGCTCTGTGCATGGACAAAT
CCCTGGCTTATATCGTCGCTGGAAAGGCAGGAATTGCCACGCCAAAGTTCCGGACGGTCACGGTGAAGGAAACCATTGAC
GCTGAACGGCTTACTTATCCCGTTTATGTCAAGCCGGCCCGTTCGGGTTCATCCTTCGGCGTCACTAAGGTATGCCGCCA
AGAAGAATTGCTGAATGCGGTGGAAATCGCCAGCCAGTATGACTCGAAGGTGCTGATTGAAGAGACTGTCATCGGCACTG
AGATAGGGTGTGCGATATTTGGGAACGATCTGGATTTGATCGCCGGCGAGGTCGATCAGATTCGTCTGTCTCATGGCTTT
TTCAGAATCCATCAGGAGAATGAGCCGGAAAAGGGTTCCGAAAACTCAACACTAATCGTTCCCGCCGGCATTTCGGCAGA
GGCGCGCTCGCGTGTTCAGGAGACGGCAAAAGCCATCTATCGCGCTTTGGGCTGCAGGGGACTGGCGCGGGTGGATATGT
TTCTGAAAGAAGATGGAACAGTAATCCTCAACGAGGTGAATACCTTGCCCGGCATGACCTCATACAGCCGTTTTCCGAGA
ATGATGGCGGCCGCAGGCTTGCCCTTTGCCGAAGTGATCGACCGGCTTGTCTCGTTGGCCTTGAAAGGAAAAACAGGAAC
CAATTGA