MEGAResFrom MEG, the Microbial Ecology Group

Notice: Trying to access array offset on value of type null in /home/meglabuser/megares.meglab.org/vendor/doctrine/annotations/lib/Doctrine/Common/Annotations/DocParser.php on line 967

VANWI

The function of the vanW genes is currently unknown. This gene is part of the VanI operon and is an accessory gene.

References

  • http://cid.oxfordjournals.org/content/42/Supplement_1/S25.full,http://www.readcube.com/articles/10.1038/ja.2013.117

Notice: Trying to access array offset on value of type null in /home/meglabuser/megares.meglab.org/vendor/doctrine/annotations/lib/Doctrine/Common/Annotations/DocParser.php on line 967

Sequences

Download Sequences

>>MEG_7545|Drugs|Glycopeptides|VanI-type_accessory_protein|VANWI
ATGTTAAGAAGGAAACCATGGGTCTTTCTTTTGGTAATTTTATTTAGTCAGCTTAGCTTATCTATACTTTTGGGGGCTAC
GGTAACCTACGGTGCGGGTTATGCGAAGGCACCCGAGGGGTTGACGGTTTGGGAAAAAGATCTGGGTGGGATGACCAAGG
ATGAGGCCTATGCAGTCCTTGCCGAAGTAATCCCCAAGGCAGTCGTCTATGACCGGACGGTTTATTTCTTGGAGCTAAAC
CAAACCGATCAAGATCTAAAGGACTATCTGGCAAGTCAATACATCATTTCCACCGGAAATGTTATTACGGATGCCTTTGA
GTACCTGCACAGAATGTCAAGGACTATCCCGTCTCCTGAGTTACTCAATCAGGAGGAAGTTCTTGCTCAGCTCCGCAAGT
TCGCCCTGGATATCGATCAGCCGGGTAAGGCGGCTGAAGCCTATTATGAGAATGGCGAGATCGTCATCGAAGAGGGCAGT
TTGGGAGTCAGACTTGATGTGGACAAATCATGGGAACAACTGCAGCAAAGCATAGGCATGGAGACGGTGCCGCTTGTTAC
GGAGGTCATAGTGGTTCACCCTACTACGGCCGAATTAGAGAAGGTCAAAGATCCCTTGGGGGATTACACCACCTATTTTA
ACCCTTCCTTTCATGAACGGGTTACCAATGTACGGCTTGCGGCTGAAGCGATCAATGGACTTATTCTTCCGCCGGGTGGT
GAATTCTCCTTTAATGATACGGTGGGAAAACGTGAGCCTGAAAGAGGGTATTTGCCGGCTTTAATGTATATGGGCAATAG
AGTTGTCACAGATGATGGCGGAGGGATTTGCCAGGATTCGACCACTCTTTATCAAGCGACCAAACAGGCCAGGCTGGAAG
TGCTGGAAAGATACAGCCATTCTCTGCCGGTTTCCTATGTTCCGTTGGGGCAGGATGCTACGGTTGCTTATGGAGCGCTG
GATTTCCGCTTTCGGAACACGACTCAGGGTTATTTGCTGCTTAATGCAGCTACAGGCGGCAATTGGATTCGGGTAAGAAT
TTTCGGTGTGGCCGATTCTGAACACCCTGCCCTTGACGAACCGGACGGTTATCCTGTAAAACCCAGAGAATGGTCAAAGT
AA

>>MEG_7546|Drugs|Glycopeptides|VanI-type_accessory_protein|VANWI
ATGTTAAACGTTGACAAGATAAGTGAAGAAACCTATTATGCGTTCATTTCTCAAGCGGATCTAGGCAATTTTATGCAGTA
TCCTTCCTGGGCCAAGGTCAAAACTGAGTGGACCAGCGATTTATTGGGGTGGTTCACCCCGGACAATAAATTGGCAGGGT
GTGGTTTGATCTTATACCGGAAAATGCCCTGCCTTAACCGGTACCTGGCGTATTGTCCCCGCGGTCCCCTTATTGACTGG
CAGAGCCCCAACCTCAGGGAATGGTTCGAACCTCTTGTGGCTTATTTGAGAAGCAAGCAGGTTTTCAGTATCAAGATCGA
TCCTCCGGTGGTCCAGGCAAAATGGTCTGCCCCCACCATTAAAACGTTTTTAGGGCAAGCCCGTGAACAGGGCAGCAAAG
GGAAAGTTTTGCGCGATTTGCCGCCGGACGAAGACTACACAACGGTCCAACAAGTGCAGCAGCAATTACGGCAAATGGGT
TGGCGGAAGCAGCGGGGGGATACGGGTTTCGCTGCGACCCAGCCCCAATATGTTTACCGCCTGCCCTTAGAGGGGCGCAG
CCTGGAGGAGGTCTTCGCCGGTTTTCATACCAACTGGAGGCGCAATGTTAAAAAGGCCGAGCGTTTGGGCGTCAAGGTCC
GGGTCGGGACCGAACAGGATTTACCGGCTTTTTATGAGCTGCTGAAGGTAACTTCAGAACGGGATCACTTCAAGGTGCGC
AGTTTCTCCTACTTTTCCAATCTGTACCGGTCCTTAAAGGCTGAAGCGGCAGACCGTATTGCTCTTTATCTGGCGGAAGA
TGAAGAGGAATTATTGGCTGCTACCTTAGCCGTCCATTCCAACGCCCACTCATGGTATCTTTACGGGGCCAGCAGCAATG
TAAAACGGGAGAAGGCCCCGAATCATGCTATCCAGTGGCGGATGATTCAAGATGCTTATCAGCTTAAGGCCTACACCTAT
GATTTTAGAGGCATCAGCCCTACCCTGGATGAATCTGACCCCCTGTTTGGGTTGTTGAGATTTAAATTGGGCTTTGGAGG
CGAGGCTTGTGAAATGATCAGTGCTTGGGACTACCCCCTGCAGCCTTTATTATACCGGGCTTTCCAGCTGTACTTAAAAC
GGCGGTAG