MEGAResFrom MEG, the Microbial Ecology Group

Notice: Trying to access array offset on value of type null in /home/meglabuser/megares.meglab.org/vendor/doctrine/annotations/lib/Doctrine/Common/Annotations/DocParser.php on line 967

VANXYG

The vanXY gene encodes a D,D-dipeptidase/D,D-carboxypeptidase. This gene is part of the VanG operon and is a core resistance gene.

References

  • http://cid.oxfordjournals.org/content/42/Supplement_1/S25.full,http://www.readcube.com/articles/10.1038/ja.2013.117

Notice: Trying to access array offset on value of type null in /home/meglabuser/megares.meglab.org/vendor/doctrine/annotations/lib/Doctrine/Common/Annotations/DocParser.php on line 967

Other Groups in VanG-type resistance protein

Sequences

Download Sequences

>>MEG_7588|Drugs|Glycopeptides|VanG-type_resistance_protein|VANXYG
atgatgaaaacgattgagcttgaaaaggaagaaatttattgtggaaatttgctgctcgtcaacaaaaattatccgctacg
agataacaatgtaaagggtttagttcctgctgatgtacgctttccaaatattcttatgaagcgtgatgtggcaaatgttt
tgcagcttatttttgaaaaaatctcggcaggtaactctatcgttcctgtaagcggttatcgctcattagaagaacagaca
gccatatatgacggctctctcaaagataatggagaggattttacaagaaaatatgttgccctgccaaatcatagcgaaca
tcagacaggacttgctattgatttgggattgaacgaaaaagaaatagattttatccgtcccgatttcccctatgtcggta
tctgtaatgagtttagaaaagcagccccagactatggatttatcgaacgctatgcaaaggacaaagaagaaatcacggga
atttcacacgagccgtggcattttcgatatgtaggatacccacactcaaaaattatgcaggaaaatggtttttcacttga
agaatacacacaatttataaaagcctatctggaagataaaaaatatctttttgagcaggctcacagagctgagattgaaa
tatattatgttcctgcaaaagacgacaaaacgctgataaaaataccagaaaattgtgtttatcagatttctggtaataac
atagacggttttgttgtgaccatatggaggaaaacagatgactaa

>>MEG_7589|Drugs|Glycopeptides|VanG-type_resistance_protein|VANXYG
ATGATGAAAACGATTGAGCTTGAAAAGGAAGAAATTTATTGTGGAAATTTGCTGCTCGTCAACAAAAATTATCCGCTACG
AGATAACAATGTAAAGGGTTTAGTTCCTGCTGATATACGCTTTCCAAATATTCTTATGAAGCGTGATGTGGCAAATGTTT
TGCAGCTTATTTTTGAAAAAATCTCGGCAGGTAACTCTATCGTTCCTGTAAGCGGTTATCGCTCATTAGAAGAACAGACA
GCCATATATGACGGCTCTCTCAAAGATAATGGAGAGGATTTTACAAGAAAATATGTTGCTCTGCCCAATCATAGTGAACA
TCAAACAGGTCTTGCCATTGATTTAGGACTGAATAAAAAGGATATAGACTTTATCCGTCCCGATTTTCCCTATGACGGTA
TTTGCGATGAATTTAGGAGAGCTGCCCCAGACTATGGCTTTACCCAGCGTTATGCAAGGGATAAAGAAGAAATAACAGGG
ATTTCACACGAGCCGTGGCATTTTCGATATGTAGGATACCCACACTCAAAAATTATGCAGGAAAATGGTTTTTCACTTGA
AGAATACACACAATTTATAAAAGCCTATCTGGAAGATAACAAATATCTTTTTGAGCAGGCTCACAGAGCTGAGATTGAAA
TATATTATGTTCCTGCAAAAGACGACAAAACGCTGATAAAAATACCAGAAAATTGTGTTTATCAGATTTCTGGTAATAAC
ATAGACGGTTTTGTTGTGACCATATGGAGGAAAACAGATGACTAA