MEGAResFrom MEG, the Microbial Ecology Group

Notice: Trying to access array offset on value of type null in /home/meglabuser/megares.meglab.org/vendor/doctrine/annotations/lib/Doctrine/Common/Annotations/DocParser.php on line 967

VANTE

The vanT gene encodes a serine/alanine racemase. This gene is part of the VanE operon and is a core resistance gene.

References

  • http://cid.oxfordjournals.org/content/42/Supplement_1/S25.full,http://www.readcube.com/articles/10.1038/ja.2013.117

Notice: Trying to access array offset on value of type null in /home/meglabuser/megares.meglab.org/vendor/doctrine/annotations/lib/Doctrine/Common/Annotations/DocParser.php on line 967

Other Groups in VanE-type resistance protein

Sequences

Download Sequences

>>MEG_7530|Drugs|Glycopeptides|VanE-type_resistance_protein|VANTE
ATGAAGCATAGAGCTAACGGCATTGATCTATTTCGAATATTCGCTGCTACTATGGTTGTTGCTATCCATACATTCCCTTT
TCAATCAATAGCACCTTTTTTAGACGAAGTCATAACGTTAACTGTGTTTCGGGTAGCTGTCCCTTTTTTCTTTATGATTA
CAGGATATTTTTTGTTAGGAAGATTGTCATTAAATTTTTCGTATAATAATAATCAGAGAGTGAAAAAATATCTATACAAA
ATTGGAATGATTTATTTATATTCTATTTTATTGTATTTCCCATTATCTTTACTAAATGGCACTATTTCATTAAAAATGAA
CATACTTTTACTTTTAAAGGTTTTCATTTTTGACGGTACCTTTTATCACCTATGGTACTTTCCAGCTAGTATAATTGGAA
CGATTTTAGTAACCCTACTGTTACGTAGTATAGGATTTAAATTAACAGTCGCATTTTCTACATGTCTATATCTAGTTGGA
CTTGGTGGAGACAGCTGGTACGGGATAACCAATCAAGTTCCATTGCTAAATAAACTGTATACATTTATTTTTAGTTGGTC
GGACTATACGCGTTCAGGTGTTTTCTTTACGCCTGTGTTTCTTTGCCTAGGAATATTTGCCTATAGAGTATCTAAAAAGT
TAACTGCATCAAAGATATTAAACTTGCTTTTTTATGTGTTTATCATAGGTATGACTTTTGAGAGTATATTTCTACACCGA
TTTACGAACGTCAAACACGATAGTATGTATCTCTTATTGCCTTCATGTGCATTAATTTTGTTTTTAATGTTATTAAACTG
GCAACCAAAACTAAAGGTAAAAGAATCAGCCGATTTAACGTTACTGGTTTATATTCTCCATCCATTAGTTATTGTAATTG
TCCATTCTATAAGTAAGTATATTCCGATATTAAAAAACAGTTTGCTAAATTTCTTGTTAGTAGTCGTGTGCAGCTTTATA
CTAGCTCAGCTTCTGTTAAACTTAAAAAGAAAGCTAAGAGTTAGTAAGCAAAAAATACCATTTGAACGTGCTAGTAAAGA
AATATCAGCTAGTGCAATACACCATAATATTAATGAAATACGAAAGATAATTCCCAAAAATACAAATATTATGGGTGTTG
TGAAGGCAAATGCGTATGGCTGTGGCATGGTAGAGGTAGCTTATGAATTAGAAAAAATCGGTATTTCATTTTTCTGCGTA
GCTACTATAGAAGAAGCAATTGCTTTAAGGAAATCAGGAAACCAAGGGGATATTTTAATTTTAGGGTATACACATCCCAA
TCGCATTAATGATATAAAAAAATATAATTTGATTCAATCGATTGTAAGTGAAGAACATGGGAAAGTGTTGAATCTAAAAA
AAATACCTATTCGTTGTCATTTACAGGTTGATACTGGGATGCATCGTTTAGGTGTTACACCGAACGTAACAATTATTCAG
CAGATGTATCTTTTTTCCAATCTTAAGATTGAGGGGATATACTCACACTTAGGTTCTTCAGACTCATTAGAGCAAGAATC
AATCGCTCGAACAAATACTCAAATTTTTTTATTCAATAATATACTAAGTGATTTGGAACAAATGGGTATTTCCTACGGTT
ATACTCATATCCAAAGCAGCTATGGTATTTTAAATTACCCAGAATTAAGCTTTGATTTTGTGAGAATAGGAATTCTCTGT
TATGGATTTTTAAGTGACTATAATAGTCCGACTAAAATCCCTATAGATTTACAACCTATAGTAAAAGTAAAAGCCTCTTT
GATTACAGAAAGAATTGTGGAGGCAGGTGAATATGTTGGCTATGGATTAGGCGCTAAAGTTGAAAAAAGAACAAGAATAG
GTGTCGTTAGTATTGGGTATGCGGACGGTATACCAAGGGCATTATCCAATGCTAAACTTACGTTAGAGTTTAAAGGTCAA
TCAATAAAACAGATTGGGAATATTTGTATGGATATGATGCTTGTTGATCTGTCCGAAGTGGAAGATATTTCCTTGAATGA
TGAACTAATCGTGTTACCTAATATTAGTAAAATCGCTGATGAAGAACAAACAATTACCAATGAGCTATTGAGTCGATTAG
GTTCGAGGTTAGGTACAGAGTTAAATTGA