MEGAResFrom MEG, the Microbial Ecology Group

Notice: Trying to access array offset on value of type null in /home/meglabuser/megares.meglab.org/vendor/doctrine/annotations/lib/Doctrine/Common/Annotations/DocParser.php on line 967

VANE

The vanE gene encodes a D-ala-D-ser ligase. This gene is part of the VanE operon and is a core resistance gene.

References

  • http://cid.oxfordjournals.org/content/42/Supplement_1/S25.full,http://www.readcube.com/articles/10.1038/ja.2013.117

Notice: Trying to access array offset on value of type null in /home/meglabuser/megares.meglab.org/vendor/doctrine/annotations/lib/Doctrine/Common/Annotations/DocParser.php on line 967

Other Groups in VanE-type resistance protein

Sequences

Download Sequences

>>MEG_7390|Drugs|Glycopeptides|VanE-type_resistance_protein|VANE
ATGAAGACAGTTGCGATTATCTTTGGCGGAGTTTCTTCTGAATATGAAGTTTCACTGAAATCTGCTGTAGCGATTATTAA
AAATATGGAATCTATTGATTATAACGTAATGAAAATAGGGATCACCGAAGAAGGTCATTGGTATCTATTTGAAGGAACGA
CAGACAAAATAAAGAAAGATCGTTGGTTTTTAGATGAAAGCTGTGAAGAAATCGTAGTTGATTTCGCAAAAAAAAGCTTT
GTATTGAAAAACAGTAAAAAAATAATCAAGCCTGATATTTTATTCCCAGTTTTACATGGAGGTTATGGTGAGAATGGTGC
TATGCAGGGAGTATTTGAGTTATTAGATATTCCATATGTAGGTTGTGGTATCGGAGCTGCAGCAATCTCTATGAATAAAA
TAATGCTCCATCAATTTGCTGAAGCAATTGGTGTAAAAAGCACCCCTAGTATGATTATAGAAAAGGGACAAGACCTACAA
AAAGTCGATGCGTTTGCGAAAATACATGGATTTCCTTTATATATTAAACCGAATGAGGCAGGCTCATCAAAAGGAATTAG
CAAGGTAGAACGAAAAAGTGATTTATATAAAGCAATAGACGAAGCTTCAAAATATGATAGTCGTATTTTAATTCAAAAGG
AAGTGAAAGGGGTAGAAATTGGTTGTGGTATTTTAGGAAATGAACAATTGGTCGTTGGAGAATGTGACCAAATCAGTCTT
GTGGATGGCTTTTTCGATTATGAAGAGAAATACAATTTAGTAACAGCAGAAATTTTGTTACCAGCTAAACTATCAATAGA
CAAAAAAGAAGATATTCAGATGAAAGCAAAAAAACTATACAGACTATTAGGATGCAAAGGATTAGCGAGAATCGACTTTT
TCTTAACTGATGACGGAGAAATTTTATTAAATGAAATCAATACAATGCCTGGTTTTACAGAGCATTCGAGATTTCCAATG
ATGATGAATGAGATTGGGATGGACTACAAAGAGATTATAGAAAACCTATTAGTATTGGCGGTGGAAAATCATGAAAAAAA
ATTATCTACGATTGATTAATGAAAACAATGAAATAAAAGACTCTGAGAGACCAAGTCACCTTGTTCAGGCTCCGTTTGCA
CAAACAAATATACTAGTTGATCCTATGGTAGCGATACAGCTAGAAAAACTAATAAAGACAACAGGTCTTGATAGCCAAAT
TATTACCATTGATGGCTATCGTTCAAAGGAGACACAGCAAGCACTTTGGGATGAGACGATTCAAGAAAAAGGGCTTGAAT
TTGCGCACAAATATGTGGCAAAGCCTGGATGTAGTGAACATGAAATTGGTTTAGCAGTGGATTTGGGGTTAGCTACGAAA
GAAAATGATTTTATTCGCCCAAGTTTCACTGATAGTCCGATTGTTGATAAATTTTTAAAGCATATGACAGATTTCGGCTT
TATCTTAAGATATCAAAAAGGAAAAGAATCTATTACCAATATAAACTATGAACCATGGCATTTCAGGTATGTAGGGACAC
CCCATAGTTCGATTATGGTACAGCAAAACTGGGTATTAGAAGAATACATTGAATTCATTGAGTCAATAAGAGGAACTGCT
TATGAAGCATAG

>>MEG_7391|Drugs|Glycopeptides|VanE-type_resistance_protein|VANE
CAGGGAGTATTTGAGTTATTAGATATTCCATATGTAGGTTGTGGTATCGGAGCTGCAGCAATTTCCATGAATAAAATAAT
GCTCCATCAATTTGCTGAAATAGTTGGTGTAAAAAGCACTCCTAGTATGATTATAGAAAAGGGACAAGACCTACAAAAAG
TCGATGAATTTGCGAAAATACATGGATTTCCTTTATATATCAAACCGAATGAGGCAGGCTCATCAAAAGGAATTAGCAAG
GTAGAACAAAAAAGTGATTTATATAAAGCAATAGACGAAGCTTCAAAATATGATAGCCGTATTTTAATTCAAAAGGAAGT
GAAAGGGGTAGAAATTGGCTGTGGGATTTTAGGGAATGAACAATTGGTCGTTGGAGAATGTGATCAAATTAGTCTTGTGG
ATGGCTTTTTCGACTATGAAGAGAAATACAATTTAGTAACAGCAGAAATTTTGTTACCAGCTAAACTATCAATAGACAAA
AAAGAAGACATCCAGATAAAAGCAAAAAAACTATACAGACTATTAGGGTGCAAAGGATTAGCGAGAATCGACTTTTTCTT
AACGGATGACGGAGAAATTTTATTAAATGAGATCAACACCCTCC