Warning: "continue" targeting switch is equivalent to "break". Did you mean to use "continue 2"? in /home/meglabuser/megares.meglab.org/vendor/doctrine/orm/lib/Doctrine/ORM/UnitOfWork.php on line 2640
MEGARes
MEGAResFrom MEG, the Microbial Ecology Group

Notice: Trying to access array offset on value of type null in /home/meglabuser/megares.meglab.org/vendor/doctrine/annotations/lib/Doctrine/Common/Annotations/DocParser.php on line 967

VANRE

The vanR gene encodes a response regulator that is part of the two-component sensor-kinase system. This gene is part of the VanE operon and is a regulator gene.

References

  • http://cid.oxfordjournals.org/content/42/Supplement_1/S25.full,http://www.readcube.com/articles/10.1038/ja.2013.117

Deprecated: The behavior of unparenthesized expressions containing both '.' and '+'/'-' will change in PHP 8: '+'/'-' will take a higher precedence in /home/meglabuser/megares.meglab.org/src/Sequence.php on line 169

Notice: Trying to access array offset on value of type null in /home/meglabuser/megares.meglab.org/vendor/doctrine/annotations/lib/Doctrine/Common/Annotations/DocParser.php on line 967

Other Groups in VanE-type regulator

Sequences

Download Sequences

>>MEG_7480|Drugs|Glycopeptides|VanE-type_regulator|VANRE
ATGGCTAAAATACTAATTTTAGATGATGAAAAAGAGATTGTAAGTCTTCTAAGTACGCTACTTTCTAACGAAGGATATGA
GGTTTATGAGGCTATGTCAGGAAAAGAAAGCTTGGAGATTATAGAAAATAACAAGATCGATTTAGCCATACTAGATGTCA
TGCTTCCCGATATTTCCGGTTTTGATGTATTGCAAAGCATTAGAGAAAAACAATTTTTTCCTGTGTTGATGCTAACTGCT
CGAGGTCAGGATATGGATAAAATTACTGGACTGTCTATGGGGGCAGATGACTATATTGTTAAGCCGTTCAATCCTTTTGA
AGTGTTGGCTAGAGTGAAAACACAGCTACGTAGATATCAAACGTATAATTCTCAAAGTATAGATGAAACAAATGAATATG
CAAAAAATGGATTAAATATATCTGTCAACAGTCGAAAAGTATTCTTATATGATGAAGAAATTAAATTAACGCCTATTGAA
TTTGATATCTTGTGGTATTTGTGTAGAAATGAAGGTCGCGTAATATCGTCAGAAGAGTTATTTGAAAAAGTCTGGAAAGA
AGACTATCTAGAGAATAATAATACTGTTATGGCGCATATTGCTAAAATTAGAGAAAAGATGCATGAAAAGCCGAGACAGC
CAAATATTATAAAAACGGTATGGGGAGTAGGTTATACAATTGAAAAATAA