MEGAResFrom MEG, the Microbial Ecology Group

Notice: Trying to access array offset on value of type null in /home/meglabuser/megares.meglab.org/vendor/doctrine/annotations/lib/Doctrine/Common/Annotations/DocParser.php on line 967

VANSD

The vanS gene encodes a sensory His-kinase and is part of the two-component sensor-kinase system. This gene is part of the VanD operon and is a regulator gene.

References

  • http://cid.oxfordjournals.org/content/42/Supplement_1/S25.full,http://www.readcube.com/articles/10.1038/ja.2013.117

Notice: Trying to access array offset on value of type null in /home/meglabuser/megares.meglab.org/vendor/doctrine/annotations/lib/Doctrine/Common/Annotations/DocParser.php on line 967

Other Groups in VanD-type regulator

Sequences

Download Sequences

>>MEG_7504|Drugs|Glycopeptides|VanD-type_regulator|VANSD
ttgaaaaatagaaagaaaacaaaatatgaagatgactatttgcttttcaaaaacagattatccatcaaaatgcttctcat
gatggtgtgctcccttctgattatagcgggtgtttatctgtttatcttaaaaggaaattttgcaaatgccgtagtttcca
ttttagaacattttgtttaccatgaccgcgatgaggccgcagtggtttatttgaaaacctttaagagatatgaattttgg
cttttcctgttggcgattttgggcgtgttttttgtgatttttcgtatgtttgtgggcaatgtttcaaaatactttaagga
gatcaaccgtggcattgattccctggtacatgaagatgccgaggatattgcccttccggcagaactggcttcaacggaaa
gaaagatcaattccatacggcataccctggcgaaaagaaagacggacgccgagcttgcggagcaacggaaaaatgacctt
gttatgtacctggcccatgacttaaaaacgccgctttcatcggtgatcggatatttgaccctgttaagggatgaaggcca
gatttccgatgaactccgggaacggtatttatccatatcactggataaggcagaacgccttgaagatctgattaacgaat
tttttgagatcacacggttcaacctttcccatattacacttgtatacggcaaaatcaatctgacaagaatgctcgaacag
ttggcatacgagtttaagccgatgctggccgggaaaaacctgaagctggaatttgaaatacagccggatatttctatttc
gtgtgatgcaaataaaatgcagcgtgtatttgataacctgctgcgaaacgctgtcagctattgtaatgcagatacaagca
ttaagataactgcggagcagatggaagatcatgtgatcattaaagtcataaacgagggaaatacaattccgcaggaacga
ttagaaagaatatttgagcagttctaccgcctggatgtatcaagaagctccgcaacgggcggggccggcctgggactcgc
cattgcaaaggagattgttgaacttcatcatgggcagattaccgcccacagtgcggacggcctcacctgctttgaggtgt
cattgccgctcgtaggaaaatcgtaa

>>MEG_7505|Drugs|Glycopeptides|VanD-type_regulator|VANSD
ttgaaaaatagaaataaaaccagtcatgaagatgactatttactttttaaaaacagattgtccgttaaaatactgcttat
gatggtatattccattctgattattgcgggtgtttatctgtttatcttaaaagataattttgcaaatgtcgtggtagcca
ttttagacagctttatctatcatgatcgggatgaggcggtggctgtttatctgagaacctttaaggcgtctgagatatgg
cttttcctgatagcggttatgggcgtgttttttatgatcttccgccgttatctggacagtatttcaaaatattttaagga
gatcaaccgggggatcgatactttggtgaatgaggatgccaacgatattgggctgcctccggagttggcttcgaccgaaa
gaaaaatcaattccatacggcataccctgacgaaacggaaaacggacgctgagcttgcagagcaaaggaaaaacgatctt
gtcatgtatctggcccatgacctgaagaccccgcttccatcggtcataggatatttgaacctgttaagggatgagaatca
gatttccgaggaacttagggaaaaatatttgtccatatcattggataaggctgagcgtctggaagaactgattaatgagt
tttttgaaattacgaggtttaatctttcaaacatcacgcttgtgtacagcaaaatcaatctgacgatgatgctggaacag
ctggggtatgagtttaagccgatgctggccgggaaaaatctgaaatgtgaatttgatgttcagccagacatgatgctgtc
ctgcgatgccaacaagctgcagcgggtcttcgataatgtgctgagaaatgccgtcagctactgctatgagaataccacca
ttcgggtgaaagccaggcagaccgaagaccatgtactcatcaaaatcataaacgaaggggatacgattcctggggagaga
ttggaaagaatctttgagcagttttaccgcctggatgtatctcgaagctcaagtaccggcggggccggtctggggcttgc
cattgcaaaagagattgtggaactgcaccatggacagatcactgcccacagcgaaaatggtatcaccagttttgaggtta
cattgcccgtcgtaggaaaatcgtaa

>>MEG_7506|Drugs|Glycopeptides|VanD-type_regulator|VANSD
ttgaaaaatagaaataaaaccagtcatgaagatgactatttactttttaaaaacagattgtccgttaaaatattgcttat
gatggtatattccattctaattattgcgggtgtttatctgtttatcttaaaagataattttgcaaatgtcgtggtagcca
ttttagacagctttatctatcatgatcgggatgaggcggtggctgtttatctgagaacctttaaggcgtatgagatatgg
cttttcctgatagcggttatgggcgtgttttttatgatcttccgccgttatctggacagtatttcaaaatattttaagga
gatcaaccgggggatcgatactttggtgaatgaggatgccaacgatattgggctgcctccggagttggcttcgaccgaaa
gaaaaatcaattccatacggcataccctgacgaaacggaaaacggacgctgagcttgcagagcaaaggaaaaacgatctt
gtcatgtatctggtccatgacctgaagaccccgctttcatcggtcataggatatttgaacctgttaagggatgagaatca
gatttccgaggaactcagggaaaaatatttgtccatatcattggataaggctgagcgtctggaagaactgatcaatgagt
tttttgaaattacgaggtttaatctttcaaacatcacgcttgtgtacagcaaaatcaatctgacgatgatgctggaacag
ctggggcacgagtttaagccgatgctggctgggaaaaatctgatatgtgaatttgatgttcagccggacatgatgctgtc
ctgtgatgccaacaagctgcagcgggtgttcgataatgtgctgagaaatgccgtcagttactgctatgagaataccacca
ttcgggtgaaagccaggcagaccgaagaccatgtactcatccaaatcataaacgaaggggatacgattcctggggagaga
ttggaaagaatctttgagcagttttaccgcctggatgtatctcgaagctcaagtaccggcggggccggtctggggcttgc
cattgcaaaagagattgtggaactgcaccatggacagatcactgcccgcagcgaaaatggtatcaccagttttgaggttg
cattgcccgtcgtaggaaaatcgtaa

>>MEG_7507|Drugs|Glycopeptides|VanD-type_regulator|VANSD
TTGAAAAATAAAAATATGACCAGTTATGAGGATGACTATTTACTTTTTAAAAACAGACTGTCCGTTAAAATACTGCTGAT
GATGGCGTGCTCCATTCTGATTATATCGGTGGTTTATCTGTTCGTCTTAAAGGATAATTTTGCAAATGTGGTGGTAGCCA
TATTGGACCGTTTCATTTATCATGACCGGGATGAAGCGGTGGCTGTTTACCTGAGAACCTTTAAGGCGTATGAGATATGG
CTTTTCCTGATCGCCGTCATGGGTGTGTTTTTCGTTATTTTTCGTCGTTATCTGGACAGCATCTCAAAGTATTTTAAGGA
GATCAACCGGGGGATTGATACACTGGTGCATGAAGATACCAATGATATCGCCCTGCCTCCGGAACTGGCTTCGACCGAAA
GGAAAATCAATTCCATACGGCATACCCTGACGAAGCGGAAAACAGACGCCGAGCTTGCGGAACAGCGGAAAAACGACCTT
GTCATGTACCTGGCTCATGACTTGAAGATCCCGCTTTCATCGGTCATAGGGTATTTGAACCTGTTAAGGGATGAGAAGCA
GATCTCCGAGGAACTCCGGGAAAAATATCTGTCCATTTCACTGGATAAGGCGGAACGTCTGGAAGAGCTGATCAATGAGT
TTTTTGAAATTACGAGGTTTAATCTTTCAAACATCACGCTTGTGTACAGCAAAATCAATCTGACGATGATGCTGGAACAG
CTGGGGCACGAGTTTAAGCCGATGCTGGCCGGGAAAAATCTCAAATGTGAATTTGATATTCAGCCGGACATGCTGCTGTC
CTGTGATGCCAACAAGCTGCAGAGAGTGTTTGATAATCTGCTGAGAAATGCCGTCAGCTACTGTTATGAGAACACCACCA
TTCAGGTGAATGCCAGGCAGGCGGAAGATCATGTGCTCATCAAAATCATAAACGAAGGGGATACGATTCCGCGGGAAAGG
TTAGAAAGAATCTTTGAGCAGTTTTATCGCCTTGATATGTCGCGAAGCTCAAGCACCGGCGGAGCCGGTCTGGGACTTGC
GATTGCAAGGGAGATTGTGGAACTGCACCATGGACAGATCACTGCCCGCAGCGAAAACGGTATCACCAGTTTTGAGGTTA
CATTGCCCACCGTAGGAAAATCGTAA

>>MEG_7508|Drugs|Glycopeptides|VanD-type_regulator|VANSD
TTGAAAAATAGAAATAAAACCAGTCATGAAGATGACTATTTACTTTTTAAAAACAGATTGTCCGTTAAAATATTGCTTAT
GATGGCGTGCTCCATTCTGATTATTGCGGGTGTTTATCTGTTTATCTTAAAAGATAATTTTGCAAATGTCGTGGTAGCCA
TTTTAGACAGCTTTATCTATCATGATCGGGATGAGGCGGTGGTTGTTTATCTGAGAACCTTTAAGGCGTATGAGATATGG
CTTTTCCTGATAGCGGTTATGGGTGTGTTTTTTATGATCTTTCGCCGCTATCTGGACAGCATTTCAAAATATTTTAAGGA
GATCAACCGTGGGATCGATACTTTGGTGAATGAGGATGCCAACGATATCACATTGCCTCCGGAGTTGGCTTCGACCGAAA
GGAAAATCAATTCCATACGGCATACCCTGACGAAACGGAAAACGGACGCTGAGCTTGCAGAGCAAAGGAAAAACGACCTT
GTCATGTATCTGGCCCATGACCTGAAGACCCCGCTTTCATCGGTCATAGGATATTTGAACCTATTAAGGGATGAGAATCA
GATCTCCGAGGAACTCAGGGAAAAATATCTGTCCATATCATTGGATAAGGCTGAGCGTCTGGAAGAGCTGATCAATGAGT
TTTTTGAAATTACGAGGTTAATCTTTCAAATATCACGCTTGTGTACAGCAAAATCAATCTGA

>>MEG_7509|Drugs|Glycopeptides|VanD-type_regulator|VANSD
TTGAAAAATAGAGATAAAACCAGTCATGAAGATGACTATTTACTTTTTAAAAACAGACTGTCCCTTAAAATACTGCTGAT
AATGGCATGCTCCATTCTAATTATAGCGGCAGTGTATCTATTCGTTTTAAAAGATAATTTTGCAAATGTGGTGGTAGCCA
TTTTAGATAGCTTTATCTATCATGATCGGGATGAGGCGGTGGCTGTTTATCTGAGAACCTTTAAGGCGTATGAGATATGG
CTTTTTCTGATAGCGGTTATGGGTGTGTTTTTTATGATCTTTCGCCGTTATCTGGACAGTATCTCAAAGTATTTTAAGGA
GATCAACCGGGGGATTGATACCCTGGTGCATGAAGATACCAATGATATCGCCCTGCCTCCGGAACTGGCTTCGACCGAAA
GAAAAATCAATTCCATACGGCATACACTGACGAAACGGAAAACGGACGCCGAGCTTGCGGAACAGCGGAAAAACGACCTT
GTTATGTACCTGGCTCATGACTTGAAGACTCCGCTTTCATCGGTTATAGGGTATTTAAACCTGTTAAGGGATGAGAATCA
AATCTCCGAGGAACTCCGGGAAAAATATCTGTCCATTTCACTGGATAAAGCTGAACGTCTGGAAGAGCTGATCAATGAGT
TTTTTGAAATTACGAGGTTTAATCTTTCAAACATCACGCTTGTGTACAGCAAAATCAATCTGACGATGATGCTGGAACAG
CTGGGGCACGAGTTTAAGCCGATGTTGGCCGGGAAAAATCTCAAATGTGAATTTGATGTTCAGCCGGACATGATGCTGTC
CTGTGATGCCAACAAACTGCAGAGAGTGTTCGATAATGTGCTGAGAAATGCCGTCAGCTACTGTTATGAGAATACTACCA
TTCAGGTGAATGCCAGGCAGGCGGAAGACTATGTGCTCATCCAAGTCATAAACGAAGGGGATACGATTCCCGGGGAGAGA
TTGGAAAGAATCTTTGAGCAGTTTTACCGCCTGGATGTGTCACAAAGCTCAAGCACCGGCGGAGCCGGTCTGGGACTTGC
GATTGCAAGGGAGATTGTGGAACTGCACCATGGACAGATCACTGCCCGCAGCGAAAACGGTATCACCAGTTTTGAGGTTA
CATTGCCCACCGTAGGAAAATCGTAA

>>MEG_7510|Drugs|Glycopeptides|VanD-type_regulator|VANSD
TTGAAAAATAGAAATAAAACCAGTCATGAAGATGACTATTTACTTTTTAAAAACAGATTGTCCGTTAAAATACTGCTTAT
GATGGTATATTCCATTCTGATTATTGCGGGCGTTTATCTGTTTATCTTAAAAGATAATTTTGCAAATGTCGTGGTAGCTA
TTTTAGACAGTTTTATCTATCATGATCGGGATGAGGCGGTGGCTGTTTATCTGAGAACCTTTAAGGCGTATGAGATATGG
CTTTTCCTGATAGCGGTTATGGGCGTGTTTTTTATGATCTTCCGCCGTTATCTGGACAGTATTTCAAAATATTTTAAGGA
GATCAACCGGGGGATCGATACTTTGGTGAATGAGGATGCCAACGATATTGGGCTGCCTCCGGAGTTGGCTTCGACCGAAA
GAAAAATCAATTCCATACGGCATACCCTGACGAAACGGAAAACGGACGCCGAGCTTGCGGAACAGCGGAAAAACGACCTT
GTCATGTACCTGGCTCATGACTTGAAGACTCCGCTTTCATCGGTCATAGGATATTTGAACCTGTTAAGGGATGAGAATCA
GATCTCCGAGGAACTCCGGGAAAAATATCTGTCCATTTCACTGGATAAGGCTGAACGTCTGGAAGAGCTGATCAATGAGT
TTTTTGAAATTACGAGGTTTAATCTTTCAACATCACGCTTGTGTACAGCAAAATCAATCTGA