MEGAResFrom MEG, the Microbial Ecology Group

Notice: Trying to access array offset on value of type null in /home/meglabuser/megares.meglab.org/vendor/doctrine/annotations/lib/Doctrine/Common/Annotations/DocParser.php on line 967

VANRD

The vanR gene encodes a response regulator that is part of the two-component sensor-kinase system. This gene is part of the VanD operon and is a regulator gene.

References

  • http://cid.oxfordjournals.org/content/42/Supplement_1/S25.full,http://www.readcube.com/articles/10.1038/ja.2013.117

Notice: Trying to access array offset on value of type null in /home/meglabuser/megares.meglab.org/vendor/doctrine/annotations/lib/Doctrine/Common/Annotations/DocParser.php on line 967

Other Groups in VanD-type regulator

Sequences

Download Sequences

>>MEG_7475|Drugs|Glycopeptides|VanD-type_regulator|VANRD
atgaatgaaaaaatcttagtggttgatgatgaaaaagaattggccgacttagttgaagtatatctgaaaaacgatggata
taccgtttataaattttataatggcaaggatgcactaaagtgtattgaatccgtggaactggatttagccatattggata
tcatgcttccggatgtagacgggtttcagatctgccaaaaaatccgggaaaagttttacttccctgttatcatgctgaca
gcaaaagtggaggacggagataaaatcatgggactgtccgtggcagatgattatattacgaagccatttaacccgctgga
aatggttgcgagagtaaaggcgcagctaaggcagtatatgcggtacaagcagcccagcttaaagcaggaggctgaatgca
cagaatacgatatcagagggatgacaatcagcaagagcagccataagtgtatcctgtttggaaaggagattcagctgacg
ccaacggagttttcgattctttggtatctgtgcgagcgtcaggggacggttgtttctacggaggaattatttgaggcagt
atggggcgaacggtattttgacagcaataataccgtgatggcgcatatcgggcgtctccgggagaaaatgaaggaaccgt
caagaaatccgaaatttataaaaactgtgtggggagtgggatataccattgaaaaatag

>>MEG_7476|Drugs|Glycopeptides|VanD-type_regulator|VANRD
atgaatgaaaaaatcttagtggttgatgatgaaaaagaattggccgacttagttgaagtatatctgaaaaacgatggata
taccgtttataaattttataatggcaaggatgcactaaagtgtattgaatccgtggaactggatttagccatattggata
tcatgcttccggatgtagacgggtttcagatctgccagaaaatccgggaaaagttttacttccctgttatcatgctgaca
gcaaaagtggaggacggggataaaatcatgggactgtccgtggcggatgattatattacaaagccgtttaacccgctgga
agtggttgcgagagtaaaggcgcagctgcggcagtacatgcggtacaagcagcccagcttaaagcaggaggctgaatgca
cagaatacgatatcagagggatgacaatcagcaagagcagccataagtgtatcctgtttggaaaggagattcagctgacg
ccaacggagttttcgattctttggtatctgtgcgagcgtcagggtacggttgtttctacggaggaattatttgaggcagt
atggggtgaacggttttttgacagcaataatactgtgatggcgcatatcgggcggctccgggagaaaatgaaggaaccgt
caagaaatccgaaatttataaaaactgtgtggggagtgggatataccattgaaaaatag

>>MEG_7477|Drugs|Glycopeptides|VanD-type_regulator|VANRD
atgaatgaaaaaatcttagtggttgatgatgaaaaagagttagccgatttggttgaagtctatctgaaaaacgatggata
caccgtttataaattttataatggcacggatgcgttaaagtgtatcgagtccacccctctggatttagccatattggata
ttatgctcccggatattgatggctttcaaatttgccagaaaatccgggagaaattttattttcctgtgatcatgctaacg
gcaaaagttgaagatggggataaaatcatggggctctccatcgcagatgactatattaccaagcccttcaatccgctgga
agtagttgccagagtgaaagcgcagttaaggcagtatatgaggtacagacagccccacttcaaacaggaggatgaacgca
gcgaatacgatataagaggaatgacaatcagtaagaacagccacaaatgtatcttgttcgggaaagaacttcaactaacg
ccaacagagttttctattctctggtatctgtgtgaaaaccaggggaaggttgtttcaacggaggaactatttgaagcggt
atggggcgaaaaatacatggataacaataatactgttatggcccatattggacgtctcagagaaaaaatgaaggaacggg
caaagaaccctaaatttataaaaactgtgtggggagtgggatataccattgaaaaatag

>>MEG_7478|Drugs|Glycopeptides|VanD-type_regulator|VANRD
ATGAATGAAAAAATCTTAGTGGTTGATGATGAAAAAGAATTGGCCGACTTAGTTGAAGTATATCTGAAAAACGATGGATA
TACCGTTTATAAATTTTATAATGGCAAGGATGCACTAAAGTGTATTGAATCCGTGGAACTGGATTTAGCCATATTGGATA
TCATGCTTCCGGATGTAGACGGGTTTCAGATCTGCCAGAAAATCCGGGAAAAGTTTTACTTCCCTGTTATCATGCTGACA
GCAAAAGTGGAGGACGGGGATAAAATCATGGGACTGTCTGTGGCAGATGATTATATTACGAAGCCGTTTAACCCGTTGGA
AGTGGTTGCGAGGGTAAAGGCGCAGCTAAGGCAGTACATGCGGTACAAGCAGCCCAGCTTAAAGCAAGAGGCTGAATGCA
CAGAATACGATATCAGAGGGATGACAATTAGCAAGAGCAGCCATAAGTGTATCTTGTTTGGAAAGGAGATTCAGCTGACG
CCAACGGAATTTTCGATTCTTTGGTATCTGTGCGAGCGTCAGGGGACGGTTGTTTCTACGGAGGAATTATTTGAAGCAGT
ATGGGGGGAACGGTATTTTGACAGCAATAATACCGTGATGGCGCATATCGGACGTCTCCGGGAAAAAATGAAGGAACCGT
CAAGAAATCCGAAATTTATAAAAACCGTGTGGGGAGTGGGATATACCATTGAAAAATAG

>>MEG_7479|Drugs|Glycopeptides|VanD-type_regulator|VANRD
ATGAATGAAAAAATCTTAGTGGTTGATGATGAAAAAGAATTGGCCGATTTAGTTGAAGTATATCTGAAAAACGATGGATA
TACCGTTTATAAATTTTATAATGGCAAGGATGCACTAAAGTGTATTGAATCCGTGGAACTGGATTTAGCCATATTGGATA
TCATGCTTCCGGATGTAGACGGGTTTCAGATCTGCCAGAAAATCCGGGAAAAGTTTTACTTCCCTGTTATCATGCTGACG
GCAAAAGTGGAGGACGGGGATAAAATCATGGGACTGTCCGTGGCGGATGATTATATTACGAAGCCGTTTAACCCGCTGGA
ACTGGTTGCGAGGGTAAAGGCGCAGCTAAGGCAGTACATGCGGTACAAGCAGCCCGGCATAAAGCAGGAGGCTGAACGCA
CGGAATACGATATCCGGGGAATGACAATCAGCAAGAGCAGCCATAAGTGTATCCTGTTTGGAAAGGAAATTCAGCTGACG
CCAACAGAGTTTTCCATCCTTTGGTATCTGTGCGAGCGTCAGGGTACGGTTGTTTCTACGGAGGAATTATTTGAGGCAGT
ATGGGGTGAACGGTTTTTTGACAGCAATAATACTGTGATGGCGCATATCGGGCGGCTTCGGGAGAAAATGAAGGAACCGT
CAAGAAATCCGAAATTTATAAAAACTGTGTGGGGAGTGGGATATACCATTGAAAAATAG