MEGAResFrom MEG, the Microbial Ecology Group

Notice: Trying to access array offset on value of type null in /home/meglabuser/megares.meglab.org/vendor/doctrine/annotations/lib/Doctrine/Common/Annotations/DocParser.php on line 967

VANSC

The vanS gene encodes a sensory His-kinase and is part of the two-component sensor-kinase system. This gene is part of the VanC operon and is a regulator gene.

References

  • http://cid.oxfordjournals.org/content/42/Supplement_1/S25.full,http://www.readcube.com/articles/10.1038/ja.2013.117

Notice: Trying to access array offset on value of type null in /home/meglabuser/megares.meglab.org/vendor/doctrine/annotations/lib/Doctrine/Common/Annotations/DocParser.php on line 967

Other Groups in VanC-type regulator

Sequences

Download Sequences

>>MEG_7497|Drugs|Glycopeptides|VanC-type_regulator|VANSC
ttgaaaaatagaagtccattgatccgcaagctcttgacccaatactttatcaccacgggcatcttgatggcgatcttgat
catcattcctttcgcagtacgcttcgttgctggaatgagggtctggtatggctatgaacccatttatcaaattttacgtc
tttttgctgactattggcttctttgcttagccatcggggccttactgatttgggtgagcacaacgatttattatatgagt
aaagctatcagttatttgaatgaaacgatccaagccacaaaccaactgattgccgaacccacgaagcgaatcgttctttc
cagcaatatgattgatgtgcaagaagaaatgaaccagttgcgggagaaaaacttacaggatcaacgagccgccaaagaag
cggaacaacgaaaaaatgatttgatcgtctatctcgcacatgatttacgaacgcctttgaccagtgtgatcggctatttg
acgcttttagaagaggaaccgcagctttctaccgaactacgcgcacgctatacgaagatcgccttgcaaaaagcccaacg
gctggaactattgatcagcgaatttttcgaaatcacccgctttaatcttacaacgatcgccctgcaaactgaaaccacgg
atctgagcttgatgctggaacaattgacgtttgaatttttgccgctgttagaagaaaaaaacctccattggcaacttcag
ctacagaaaaaagtctttgcgaccgttgatacggagaaaatggaacgcgtttttgataacttgatccgcaatgccatcaa
ttatagctatcctaactcccctttgcgattagccatcagcgagtctgatgatatcctgattcgtttgaccaatcaaggaa
aaacgatcccagctgaaaagatcgtcttgatttttgagcctttctaccgcatggatgcttcccgagcaacagcgacgggt
gggacgggtcttggtttgccgatcgccaaagaaatcgttgaagcattaggtggaaagatttgggcggaaagccgtgatga
aaccatcgtcttttcgattcgcctaccgaaggcagcaatggaaaaaaatgaacagctgtcaaagccccatccatctgaac
caaccgcttaa

>>MEG_7498|Drugs|Glycopeptides|VanC-type_regulator|VANSC
ttgaaaagtaaaaatattaaagtcaatcctgactttactcaagtgagaaataaaatttttatgagaacagctttaatggc
atttatagccattattttcatatggattttatattcttttatattgtatggtaagttttctatctggatagtatcattct
ttgaaaatgcttttcgtatggaatataaagctgcattgaatttatatcagcagattttccgtaatagcatggagctcttc
atgatactagctatggtgattgtgttttttataatattccgtgtttatttaaattggtttacaaaatattttagtgaaat
aaatcaaggtattgactctcttatcaaagaagatgttggagaagtggctttatctccagagttattggcaatagaaaaga
aaataaactcaattaaacatatacttgaacaacgtaaatttgagacacaaatggcagaacaacgtaagaatgaacttatt
gtttatcttgcacatgatttaaaaacaccacttacatcagttatagggtatctgacactacttcgagatgaaagtcagat
ttctgaagaactgcgaaaaaaatatttatctatttcgttggataaggcagagcgtcttgaagatttaattaatgaattct
ttgaaattacaaggtttaatttatcaaatatatcacttgaatacagtacagtaagcttaactcgtatgcttgaacaacta
acatatgagtttaaacctactttgatgagtaagaatttaaaatatacactgaatgttacaccaaatatgatgataaggtg
tgatgttaataaaatgcaacgtgtatttgataacttattacgaaatgctgtttattatagttttgaagatactactattg
aaataacagctgtacaggaggatgattatataaagcttaaatttataaatcatagtaatatgattccagaggaaaaactt
gagcgtatttttgaacaattttacaggttggatacatctcgtaattcaaacagtggtagagctgggttgggacttgctat
agctaaagaaatagtggagcttcataacgggacaataacagctcatagcgagaacaatataattacctttaaggttatta
ttccgattgtaggaaatttgtaa

>>MEG_7499|Drugs|Glycopeptides|VanC-type_regulator|VANSC
TTGAAAAATAGAAATCCTTTGATCCGAAAGCTCTTGACCCAATACTTCGTCACCACTGGAATCTTGCTGGCATTCCTTGT
AATGATTCCATTAGTCATTCGCTTTATTGCCGGAACCCGGACTTGGTATGGAACGGAACCTATCTACTATATCTTACGTT
TTTTTGCGGATCGCTGGTTGTTTTGTGTTGCGATAGGCGCTTTACTGATATGGTTTGGTACCACCATTTACTATATGACC
AAAGCCATCGGTTATTTGAATGAAACGATCCAAGCCACGACTCAACTGATAGAAGAACCAACCAAACGCATCACTTTGTC
GAGCCATCTGGTTGATGTTCAAGAGGAAATGAATCAACTGCGGGAGAAAAGTCTGCAAGATCAACGTGCCGCTAAAGAAG
CGGAACAGCGGAAAAATGATTTGATCGTTTATCTCGCCCATGATTTGCGGACGCCTCTGACAAGTGTCATAGGTTATCTG
ACTCTTCTAAAAGAAGAACCACAATTATCCAATGCGATGCGGAATCGTTACACGGAGATTGCTTTACAAAAAGCCCAACG
GCTGGAACTATTGATCAGTGAATTCTTCGAGATCACACGCTTCAATTTGACCACGATCGTTTTGCAGACAGAAACGACTG
ATTTAAGTTTAATGCTTGAACAGCTGACCTTTGAGTTTTTACCTCTCTTGGAAGAAAAGAATCTAAATTGGCAACTCAAC
TTACAAAAAAATGTTCTTGCAACAGTAGACACCGAAAAAATAGCTCGTGTCTTTGATAATCTCATTCGCAATGCCATCAA
CTACAGCTATCCAGATTCGCCTTTACTTCTTGAATTGGTCGAATCAGACAGTATCCACATTCGTCTGACGAATCGTGGAA
AAACAATTCCAGAAGAGATGATCGGACGTCTCTTTGAACCTTTCTATCGCATGGATTCTTCCCGAGCTACAGCCACAGGC
GGAACTGGTCTTGGTCTTCCGATTGCAAAAGAGATTCTGTTAGCATCTGGCGGGGATATCTCGGCAGAAAGCAAAGACGA
AACCATCATTTTCAACGTTCGCTTGCCAAAACCTGCCAACAGCTGA

>>MEG_7500|Drugs|Glycopeptides|VanC-type_regulator|VANSC
ATCTTGATCATCATTCCTTTCGCAGTACGCTTCGTTGCTGGAATGAGGGTCTGGTATGGCTATGAACCCATTTATCAAAT
TTTACGTCTTTTTGCTGACTATTGGCTTCTTTGCTTAGCCATCGGGGCCTTACTGATTTGGGTGAGCACAACGATTTATT
ATATGAGTAAAGCTATCAGTTATTTGAATGAAACGATCCAAGCCACAAACCAACTGATTGCCGAACCCACGAAGCGAATC
GTTCTTTCCAGCAATATGATTGATGTGCAAGAAGAAATGAACCAGTTGCGAGAGAAAAACTTACAGGATCAACGAGCCGC
CAAAGAAGCGGAACAACGAAAAAATGATTTGATCGTCTATCTCGCACATGATTTACGAACGCCTTTGACCAGTGTGATCG
GCTATTTGACGCTTTTAGAAGAGGAACCACAGCTTTCTACCGAACTACGCGCACGCTATACGAAGATCGCCTTGCAAAAA
GCCCAACGGCTGGAACTATTGATCAGCGAATTTTTCGAAATCACCCGCTTTAATCTTACAACGATCGCCTTGCAAACTGA
AACCACGGATCTGAGCTTGATGCTGGAACAATTGACGTTTGAATTTTTGCCGCTGTTAGAAGAAAAAAACCTCCATTGGC
AACTTCAGCTACAGAAAAAAGTCTTTGCGACCGTTGATACGGAGAAAATGGAACGCGTTTTTGATAACTTGATCCGCAAT
GCCATCAATTATAGCTATCCTAACTCCCCTTTGCGATTAGCCATCAGCGAGTCTGATGATATCCTGATTCGTTTGACCAA
TCAAGGAAAAACGATCCCAGCTGAAAAGATCGGCTTGATTTTTGAGCCTTTCTACCGCATGGATGCTTCCCGAGCAACAG
CGACGGGTGGGACGGGTCTTGGTTTGCCGATCGCCAAAGAAATCGTTGAAGCATTAGGTGGAAAGATTTGGGCGGAAAGC
CGTGATGAAACCATCGTCTTTTCGATTCGCCTACCGAAGGCAGCAATGGAAAAAAATGAACAGCTGTCAAAGCCCCATCC
ATCTGAACCAACCGCTTAA

>>MEG_7501|Drugs|Glycopeptides|VanC-type_regulator|VANSC
ATGCTCCTTTTGATTCTGATCCCTTTAACTGTTCGCTTTGTAGCAGGATTGAGGGTTTGGTACGGCTATGAGCCCATTTA
TCAAATATTACGGCTTTTTGCTGATTATTGGCTCGTCTGTCTAGCGATCGGTGCCTTGCTGATTTGGGTGAGCACAACGA
TTTATTATATGAGTAAAGCCATCAGCTATTTGAATGAAACGATTCAAGCCACGAATCAATTGATTGCTGAACCTACGAAG
CGAATCGTTCTTTCCAGCAATCTGATCGACGTGCAAGAAGAAATGAACCAGTTGCGGGAAAAAAATCTACAGGATCAACG
AGCTGCCAAAGAAGCAGAGCAGCGGAAAAATGATTTGATCGTCTATCTCGCACATGATTTACGCACACCTTTGACCAGTG
TGATCGGCTATTTGACACTTCTAGAAGAAGAACCGCAGCTTTCTTCCGAACTACGCGCACGCTATACCAAGATCGCCTTG
CAAAAAGCCCAGCGGCTAGAATTATTGATCAGCGAATTTTTCGAAATCACTCGTTTTAATCTTACAACGATCGCCTTACA
GACCGAAACCACGGATCTTAGCTTGATGCTAGAACAGTTGACGTTCGAATTTTTACCGCTGCTAGAAGAAAAGAACCTTC
ATTGGCAACTGCAACTACAGAAAAAAGTCTATGCGACTGTCGATACAGAGAAGATGGAACGCGTCTTTGATAACTTGATT
CGCAATGCCATCAATTATAGTTATGCCGATTCCCCCTTGCATTTAGCCATCAGTACCTCTGATGATATCCTGATTCGTTT
GACCAATCATGGAAAAACGATCCCTGCTGAAAAGATTGGCTTGATTTTTGAGCCTTTTTACCGCATGGACGCTTCCCGAG
CAACGGCGACGGGTGGGACCGGTCTGGGGCTGCCGATCGCCAAAGAAATCGTTGAAGCATTAGGTGGAAAAATCTGGGCG
GAAAGCCGTGACGAAACCATCGTCTTTTCGATTCGCCTACCGAAGGTAGCAATGGAAAAAAATGAACAGCGGTCAAAGCC
CCATCCATCTGAACCAACCGCTTAA

>>MEG_7502|Drugs|Glycopeptides|VanC-type_regulator|VANSC
TTGAAAAATAGAAATCCTTTGATCCGAAAGCTCTTGACCCAATACTTCGTCACCACTGGAATCTTGCTGGCATTCCTTGT
AATGATTCCATTAGTCATTCGCTTTATTGCCGGAACCCGGACTTGGTATGGAACGGAACCTATCTACTATATCTTACGTT
TTTTTGCGGATCGCTGGTTGTTTTGTGTTGCGATTGGCGCTTTACTGATATGGTTTGGTACCACCATTTACTATATGACC
AAAGCCATCGGTTATTTGAATGAAACGATCCAAGCCACGACTCAACTGATAGAAGAACCATCCAAACGCATCACTTTATC
GAGCCATCTGATTGATGTTCAAGAGGAAATGAATCAACTGCGGGAGAAAAGTCTGCAAGATCAACGTGCCGCTAAAGAAG
CGGAACAGCGGAAAAATGATTTGATCGTTTATCTCGCCCACGATTTGCGGACGCCTCTGACAAGTGTCATAGGTTATCTG
ACTCTTCTAAAAGAAGAACCACAATTATCCAATGCGATGCGGAATCGTTACACGGAGATTGCTTTACAAAAAGCCCAACG
GCTGGAACTATTGATCAGTGAATTCTTCGAGATCACACGCTTCAATTTGACCACGATCGTTTTGCAGACAGAAACGACTG
ATTTAAGTTTAATGCTTGAACAGCTGACCTTTGAGTTTTTACCTCTCTTGGAAGAAAAGAATCTAAATTGGCAACTCAAC
TTACAAAAAAATGTTCTTGCAACAGTAGACACCGAAAAAATAGCTCGTGTCTTTGATAATCTCATTCGCAATGCCATCAA
CTACAGCTATCCAGATTCGCCTTTACTTCTTGAATTGGTCGAATCAGACAGTATTCACATTCGTCTGACGAATCGTGGAA
AAACAATTCCAGAAGAGATGATCGGACGTCTCTTTGAACCTTTCTATCGCATGGATTCTTCCCGAGCTACAGCCACAAGC
GGAACTGGTCTTGGTCTTCCGATTGCAAAAGAGATTCTGTTAGCATCTGGCGGGGATATCTCGGCAGAAAGCAAAGACGA
AACCATCATTTTCAACGTTCGCTTGCCAAAACCTGCCAACAACTGA

>>MEG_7503|Drugs|Glycopeptides|VanC-type_regulator|VANSC
ATGCTCCTCTTGATTCTGATCCCTTTAACTGTTCGCTTTGTAGCAGGATTGAGGGTTTGGTACGGCTATGAACCCATTTA
TCAAATATTACGGCTTTTTGCTGATTATTGGCTCGTCTGTCTAGCCATCGGTGCCTTGCTGATCTGGGCAAGTACAACGA
TTTATTATATGAGTAAAGCCATCAGCTATTTGAATGAAACGATCCAAGCCACGAATCAATTGATTGCCGAACCCACGAAG
CGAATCATTCTCTCCAGCAATCTGAACGATGTGCAAGAAGAAATGAACCAGTTACGGGAAAAAAATCTCCAAGATCAACG
AGCAGCCAAAGAAGCAGAGCAGCGGAAAAATGATTTGATCGTCTATCTCGCACATGATTTACGCACACCTTTGACCAGTG
TGATCGGCTACTTGACGCTGTTAGAAGAGGAACCTCAGCTTTCTACCGAACTACGGGCACGCTATACCAAGATCGCCTTG
CAAAAAGCCCAGCGGCTAGAATTATTGATCAGCGAGTTTTTCGAAATCACCCGTTTTAATCTTACAACGATCGCCTTACA
GACCGAAACCACGGATCTTAGCTTAATGCTGGAACAGTTGACGTTCGAATTTTTACCGCTGTTAGAAGAAAAGAACCTTC
ATTGGCAACTGCAGCTACAGAAAAAAGTCTTTGCGACCGTTGATACGGAGAAAATGGAACGCGTTTTTGATAACTTGATC
CGCAATGCCATCAACTATAGTTATACCGATTCCCCCTTGCATTTAGCCATCAGTGCCTCTGATGATATCTTGATTCGATT
GACCAATCATGGGAAAACGATCCCTGCTGAAAAAATTGGCTTGATTTTTGAGCCTTTTTATCGGATGGACGCTTCACGAG
CGACTGCGACTGGTGGAACCGGTCTGGGGCTGCCGATCGCCAGAGAAATCGTTGAAGCATTAGGTGGAAAAATCTGGGCG
GAAAGCCGTGACGAAACCATCGTCTTTTCGATTCGCCTACCAAAGGCAGCAATGGAAAAAAATGAACAGCGATCAAAGCC
CCATCCATCTGAACCAACCGCTTAA