MEGAResFrom MEG, the Microbial Ecology Group

Notice: Trying to access array offset on value of type null in /home/meglabuser/megares.meglab.org/vendor/doctrine/annotations/lib/Doctrine/Common/Annotations/DocParser.php on line 967

VANRC

The vanR gene encodes a response regulator that is part of the two-component sensor-kinase system. This gene is part of the VanC operon and is a regulator gene.

References

  • http://cid.oxfordjournals.org/content/42/Supplement_1/S25.full,http://www.readcube.com/articles/10.1038/ja.2013.117

Notice: Trying to access array offset on value of type null in /home/meglabuser/megares.meglab.org/vendor/doctrine/annotations/lib/Doctrine/Common/Annotations/DocParser.php on line 967

Other Groups in VanC-type regulator

Sequences

Download Sequences

>>MEG_7470|Drugs|Glycopeptides|VanC-type_regulator|VANRC
atgaacgaaaatattttgattgtggatgatgaaaaagaaatagcagatttaattgaagtatatttaaaaaatgaaggttt
tacagtatacaagttttatacaggtaaggaagctctagaatgtattgaatctaaaaatttggatatggctattttagata
ttatgcttcctgatattgatggatttcatatttgccagaaaattcgagaaaaatactattatcctatcattatgttaaca
gctaaaattgaagatatagacaagataatgggtttaaccataggtgctgatgattatataacaaagccatttaacccttt
ggaagttgttgcaagagtaaagacacaattaagaagatatatgcgatataataattcttatgaacaacagtcgataattg
ttaatgagtatgatattaaaggattgattatcaataaagaaacacataaatgtagtttatttgggaaagaagtagcatta
acaccgattgaattttctattctttggtatttatgtgaacatcaaggaaaagtggttccttctgaagaattgtttgaagc
tgtatggggagaaaaatatcttgataataataacacagttatggctcatatagggcgattacgtgaaaaaattcatgaac
cttctaaaaacccgaaatttataaaaactgtatggggagtaggttatacaattgaaaagtaa

>>MEG_7471|Drugs|Glycopeptides|VanC-type_regulator|VANRC
atggcagaaaaaataattgttgttgatgatgaaaaagaaatcgcggagttagtcacgacgtttctaaggaatgaaggctt
ccaagtagaacctttttatgatggaacgagcgctttggcctatcttgaaaaagaaacggtcgacgtggcggttttagatg
tgatgctgccggatatcgacggcttccagctgttgcagcaaattcgtaagacccactttttcccagtactgatgctcacg
gcaaaaggggaagacttggataaaatcaccggtctaagccttggggcagatgattatgtgaccaagcccttcaatccttt
agaagtcgttgctcgggtcaaaacgcagctgcggcgataccagcgttacaaccagtcagcgaatccccagaagattgaag
aatacgaaaaggaaggcttactgttgaaaatcaatagccaccaatgttttctttatggcaaagaggttttcttgaccccc
atcgaatttaaaatcttgctttacttatttgaacaccaaggatcggtcgttgcctcggaaaccctttttgaagcagtttg
gaaagaaaagtatttagacaacaataacacagtgatggcacatatcgcccgtttgcgggaaaaactgaacgaacaacccc
gcaaaccgaaattaatcaaaaccgtatggggggtcggctatatcattgaaaaatag

>>MEG_7472|Drugs|Glycopeptides|VanC-type_regulator|VANRC
ATGGCAGAAAAAATAATTGTTGTTGATGATGAAAAAGAAATCGCGGAGTTAGTCACGACGTTTCTAAGGAATGAAGGCTT
CCAAGTAGAACCTTTTTATGATGGAACGAGCGCTTTGGCTTATCTTGAAAAAGAAACGGTCGACGTGGCGGTTTTAGATG
TGATGCTGCCGGATATCGACGGCTTTCAGCTGCTGCAGCAAATTCGTAAGACCCACTTTTTCCCAGTACTGATGCTCACG
GCAAAAGGGGAAGACTTGGATAAAATCACCGGTCTAAGCCTTGGGGCAGATGATTATGTGACCAAGCCCTTCAATCCTTT
AGAAGTCGTTGCTCGGGTCAAAACGCAGCTGCGGCGATACCAGCGTTACAACCAGTCAGCGAATCCCCAGAAGATTGAAG
AATACGAAAAGGAAGGCTTACTGTTGAAAATCAACAGCCACCAATGTTTTCTTTATGGCAAAGAGGTTTTCTTGACCCCC
ATCGAATTTAAAATCTTGCTTTACTTATTTGAACACCAAGGATCGGTCGTTGCCTCGGAAACCCTTTTTGAAGCAGTTTG
GAAAGAAAAGTATCTAGACAACAATAACACAGTGATGGCACATATCGCCCGTTTGCGGGAAAAACTGAATGAACAACCCC
GCAAACCGAAATTAATCAAAACCGTATGGGGGGTCGGCTATATCATTGAAAAATAG

>>MEG_7473|Drugs|Glycopeptides|VanC-type_regulator|VANRC
ATGGCAGAAAAAATAATTGTTGTTGATGATGAAAAAGAAATCGCCGAGTTAGTCACGACGTTTCTAAGGAATGAAGGCTT
TCAAGTGGAACCTTTTTATGATGGAACGAGTGCTTTGGCTTATCTCGAAAAAGAAACAGTCGATGTGGCAGTTTTAGATG
TGATGCTGCCGGATATCGACGGCTTTCAGCTGTTACAGACCATTCGCAAAACCCACTTTTTTCCAGTACTGATGCTCACT
GCCAAAGGAGAAGATCTGGATAAAATTACCGGTCTAAGTCTAGGTGCAGATGATTATGTGACTAAGCCCTTCAATCCATT
AGAAGTTGTTGCTCGGGTCAAAACGCAACTACGGCGATACCAACGATACAATCAGTCAGCTGTTCCGCAGAAGATTGAAG
AATACGAAAAGGAAGGCTTACTGTTGAAAATCAACAGTCACCAATGTTTTCTTTATGGCAAAGAGGTTTTCTTGACCCCC
ATCGAATTTAAAATCCTGCTTTACTTATTTGAACACCAAGGATCGGTCGTTGCCTCGGAAACTCTTTTTGAAGCAGTCTG
GAAAGAAAAATATTTAGATAACAATAACACAGTGATGGCACATATTGCCCGTCTGCGGGAAAAGCTAAACGAACAACCCC
GCAAACCGAAATTAATCAAAACTGTATGGGGGGTCGGCTATATCATTGAAAAATAG

>>MEG_7474|Drugs|Glycopeptides|VanC-type_regulator|VANRC
ATGGCAGAAAAAATAATCGTTGTTGATGATGAAAAAGAAATCGCCGAGTTAGTCACGACGTTTCTAAGAAATGAAGGTTT
CCAAGTGGAACCTTTTTATGATGGAACGAGTGCTTTGGCTTATCTCGAAAAAGAAACAGTCGATGTGGCAGTTTTAGATG
TGATGCTGCCGGATATCGACGGCTTTCAGCTGTTACAGAACATTCGCAAAACCCACTTTTTTCCAGTACTGATGCTCACT
GCTAAAGGAGAAGATCTGGATAAAATTACCGGTCTAAGTCTAGGTGCAGATGATTATGTGACCAAACCTTTCAATCCATT
AGAAGTTGTTGCTCGGGTCAAAACGCAACTACGGCGATACCAACGATACAATCAGTCAGCTGTTCCGCAGAAGATTGAAG
AATACGAAAAGGAAGGCTTACTGTTGAAAATCAACAGCCACCAATGTTTTCTTTATGGCAAAGAGGTTTTTTTGACCCCA
ATCGAATTTAAAATCTTGCTTTACTTATTTGAACACCAAGGATCGGTCGTTGCCTCGGAAACCCTTTTTGAAGCAGTCTG
GAAAGAAAAATATTTAGACAACAATAACACAGTGATGGCACATATTGCCCGTCTGCGGGAAAAGCTAAACGAACAACCAC
GCAAACCGAAATTAATCAAAACTGTATGGGGGGTCGGCTATATCATTGAAAAATAG