MEGAResFrom MEG, the Microbial Ecology Group

Notice: Trying to access array offset on value of type null in /home/meglabuser/megares.meglab.org/vendor/doctrine/annotations/lib/Doctrine/Common/Annotations/DocParser.php on line 967

VANSB

The vanS gene encodes a sensory His-kinase and is part of the two-component sensor-kinase system. This gene is part of the VanB operon and is a regulator gene.

References

  • http://cid.oxfordjournals.org/content/42/Supplement_1/S25.full,http://www.readcube.com/articles/10.1038/ja.2013.117

Notice: Trying to access array offset on value of type null in /home/meglabuser/megares.meglab.org/vendor/doctrine/annotations/lib/Doctrine/Common/Annotations/DocParser.php on line 967

Other Groups in VanB-type regulator

Sequences

Download Sequences

>>MEG_7490|Drugs|Glycopeptides|VanB-type_regulator|VANSB
atggaaagaaaagggattttcattaaggttttttcctatacgatcattgtcctgctactgcttgtcggtgtaacagcaac
actgcttgcacagcaatttgtgtcttatttcagagtgatggaattacagcaaacagtaaaatcctatcagccattggtgg
aactgattcagaatagcgataggcttgatattcaagaggtggcagggctgtttcactacaataaccaatcctttgagttt
tatattgaagataaagagggaagcgtactctatgccacaccaaatgccaatacatcaaatagttttagacccgactttct
ttatgtggtacatagagatgataatatttcgattgttgctcaaaacaaggcaggtgtgggattgctttatcaagggctga
caattcggggaattgttatgattgcgataatggttgtattcagccttttatgcgcgtatatctttgcgcggcaaatgaca
acgccgatcaaagccttagcggacagtgcgaataaaatggcaaacctgaaagatgtaccgccgccgctggagcgaaagga
tgagcttggcgcactggctcatgatatgcattccatgtatgtcaggctgaaagaaaccatcgcaaggctggaggatgaaa
tcgcaagggaacatgagttggaggaaacacagcgatatttctttgcggcagcttctcatgagctaaaaacgcccatcgcg
gctacaagcgttctgttggagggaatgcttgaaaatatcggtgactacaaagatcattctaagtatctgcgcgaatgcat
caaaatgatggataggcagggcaaaatcatttccgaaatactggagcttgtcagcctgaatgatgggagaatcgtaccca
tagctgaaccgttggacatagggcgcacggttgccgagttgctgcccgattttcaaaccttggcagaggcaaacaaccag
cggttcgtcacagatattccagccgggcaaattgtcctgtccgatccgaggctgctccaaaaggcactatccaatgtcat
attgaatgcagttcagaacacgccgcagggaggcgaggtacggatatggagtgagcctggtgctgaaaaatgccgccttt
ttgttttgaacatgggcgttcacattgatgatactgcgcttccaaggctgttcaccccattctatcgcattgatcaggcg
cgaagcagaaaaagtgggcgaagcggtttaggacttgccatcgtacaaaaaacgctggatgccatgagcctccagtatgc
gctggaaaacacctcggatggcgttttgttctggctggatttaccgctcacatcaacattgtaa

>>MEG_7491|Drugs|Glycopeptides|VanB-type_regulator|VANSB
atggaaagaaaagggattttcattaaggttttttcctatacgatcattgtcctgctactgcttgtcggtgtaacagcaac
actgtttgcacagcaatttgtgtcttatttcagagtgatggaattacagcaaacagtaaaatcctatcagccattggtgg
aactgattcagaatagcgataggcttgatattcaagaggtggcagggctgtttcactacaataaccaatcctttgagttt
tatattgaagataaagagggaagcgtactctatgccacaccaaatgccaatacatcaaatagttttagacccgactttct
ttatgtggtacatagagatgataatatttcgattgttgctcaaagcaaggcaggtgtgggattgctttatcaagggctga
caattcggggaattgttatgattgcgataatggttgtattcagccttttatgcgcgtatatctttgcgcggcaaatgaca
acgccgatcaaagccttagcggacagtgcgaataaaatggcaaacctgaaagatgtaccgccgccgctggagcgaaagga
tgagcttggcgcactggctcatgatatgcattccatgtatgtcaggctgaaagaaaccatcgcaaggctggaggatgaaa
tcgcaagggaacatgagttggaggaaacacagcgatatttctttgcggcagcttctcatgagctaaaaacgcccatcgcg
gctacaagcgttctgttggagggaatgcttgaaaatatcggtgactacaaagatcattctaagtatctgcgcgaatgcat
caaaatgatggataggcagggcaaaatcatttccgaaatactggagcttgtcagcctgaatgatgggagaatcgtaccca
tagctgaaccgttggacatagggcgcacggttgccgagttgctgcccgattttcaaaccttggcagaggcaaacaaccag
cggttcgtcacagatattccagccgggcaaattgtcctgtccgatccgaggctgctccaaaaggcgctatccaatgtcat
attgaatgcagttcagaacacgccgcagggaggcgaggtacggatatggagtgagcctggtgctgaaaaatgccgccttt
ttgttttgaacatgggcgttcacattgatgatactgcgcttccaaggctgttcaccccattctatcgcattgatcaggcg
cgaagcggtttaggacttgccatcgtacaaaaaacgctggatgccatgagcctccagtatgcgctggaaaacacctcgga
tggcgttttgttctggctggatttaccgctcacatcaacactataa

>>MEG_7492|Drugs|Glycopeptides|VanB-type_regulator|VANSB
atggaaagaaaagggattttcattaaggttttttcctatacgatcattgtcctgctactgcttgtcggtgtaacagcaac
actgtttgcacagcaatttgtgtcttatttcagagtgatggaattacagcaaacagtaaaatcctatcagccattggtgg
aactgattcagaatagcgataggcttgatattcaagaggtggcagggctgtttcactacaataaccaatcctttgagttt
tatattgaagataaagagggaagcgtactctatgccacaccaaatgccaatacatcaaatagttttagacccgactttct
ttatgtggtacatagagatgataatatttcgattgttgctcaaggcaaggcaggtgtgggattgctttatcaagggctga
caattcggggaattgttatgattgcgataatggttgtattcagccttttatgcgcgtatatctttgcgcggcaaatgaca
acgccgatcaaagccttagcggacagtgcgaataaaatggcaaacctgaaagatgtaccgccgccgctggagcgaaagga
tgagcttggcgcactggctcatgatatgcattccatgtatgtcaggctgaaagaaaccatcgcaaggctggaggatgaaa
tcgcaagggaacatgagttggaggaaacacagcgatatttctttgcggcagcttctcatgagctaaaaacgcccatcgcg
gctacaagcgttctgttggagggaatgcttgaaaatatcggtgactacaaagatcattctaagtatctgcgcgaatgcat
caaaatgatggataggcagggcaaaatcatttccgaaatactggagcttgtcagcctgaatgatgggagaatcgtaccca
tagctgaaccgttggacatagggcgcacggttgccgagttgctgcccgattttcaaaccttggcagaggcaaacaaccag
cggttcgtcacagatattccagccgggcaaattgtcctgtccgatccgaggctgctccaaaaggcactatccaatgtcat
attgaatgcagttcagaacacgccgcagggaggcgaggtacggatatggagtgagcctggtgctgaaaaatgccgccttt
ttgttttgaacatgggcgttcacattgatgatactgcgcttccaaggctgttcaccccattctatcgcattgatcaggcg
cgaagcagaaaaagtgggcgaagcggtttaggacttgccatcgtacaaaaaacgctggatgccatgagcctccagtatgc
gctggaaaacacctcggatggcgttttgttctggctggatttaccgctcacatcaacattgtaa

>>MEG_7493|Drugs|Glycopeptides|VanB-type_regulator|VANSB
ATGGAAAGAAAAGGGATTTTCATTAAGGTTTTTTCCTATACGATCATTGTCCTGCTACTGCTTGTCGGTGTAACAGCAAC
ACTGTTTGCACAGCAATTTGTGTCTTATTTCAGAGTGATGGAATTACAGCAAACAGTAAAATCCTATCAGCCATTGGTGG
AACTGATTCAGAATAGCGATAGGCTTGATATTCAAGAGGTGGCAGGGCTGTTTCACTACAATAACCAATCCTTTGAGTTT
TATATTGAAGATAAAGAGGGAAGCGTACTCTATGCCACACCAAATGCCAATACATCAAATAGTTTTAGACCCGACTTTCT
TTATGTGGTACATAGAGATGATAATATTTCGATTGTTGCTCAAAGCAAGGCAGGTGTGGGATTGCTTTATCAAGGGCTGA
CAATTCGGGGAATTGTTATGATTGCGATAATGGTTGTATTCAGCCTTTTATGCGCGTATATCTTTGCGCGGCAAATGACA
ACGCCGATCAAAGCCTTAGCGGACAGTGCGAATAAAATGGCAAACCTGAAAGATGTACCGCCGCCGCTGGAGCGAAAGGA
TGAGCTTGGCGCACTGGCTCATGATATGCATTCCATGTATGTCAGGCTGAAAGAAACCATCGCAAGGCTGGAGGATGAAA
TCGCAAGGGAACATGAGTTGGAGGAAACACAGCGATATTTCTTTGCGGCAGCTTCTCATGAGCTAAAAACGCCCATCGCG
GCTACAAGCGTTCTGTTGGAGGGAATGCTTGAAAATATCGGTGACTACAAAGATCATTCTAAGTATCTGCGCGAATGCAT
CAAAATGATGGATAGGCAGGGCAAAATCATTTCCGAAATACTGGAGCTTGTCAGCCTGAATGATGGGAGAATCGTACCCA
TAGCTGAACCGTTGGACATAGGGCGCACGGTTGCCGAGTTGCTGCCCGATTTTCAAACCTTGGCAGAGGCAAACAACCAG
CGGTTCGTCACAGATATTCCAGCCGGGCAAATTGTCCTGTCCGATCCGAGGCTGCTCCAAAAGGCACTATCCAATGTCAT
ATTGAATGCAGTTCAGAACACGCCGCAGGGAGGCGAGGTACGGATATGGAGTGAGCCTGGTGCTGAAAAATGCCGCCTTT
TTGTTTTGAACATGGGCGTTCACATTGATGATACTGCGCTTCCAAGGCTGTTCACCCCATTCTATCGCATTGATCAGGCG
CGAAGCAGAAAAAGTGGGCGAAGCGGTTTAGGACTTGCCATCGTACAAAAAACGCTGGATGCCATGAGCCTCCAGTATGC
GCTGGAAAACACCTCGGATGGCGTTTTGTTCTGGCTGGATTTACCGCTCACATCAACATTGTA

>>MEG_7494|Drugs|Glycopeptides|VanB-type_regulator|VANSB
ATGGAAAGAAAAGGGATTTTCATTAAGGTTTTTTCCTATACGATCATTGTCCTGCTACTGCTTGTCGGTGTAACAGCAAC
ACTGTTTGCACAGCAATTTGTGTCTTATTTCAGAGTGATGGAATTACAGCAAACAGTAAAATCCTATCAGCCATTGGTGG
AACTGATTCAGAATAGCGATAGGCTTGATATTCAAGAGGTGGCAGGGCTGTTTCACTACAATAACCAATCCTTTGAGTTT
TATATTGAAGATAAAGAGGGAAGCGTACTCTATGCCACACCAAATGCCAATACATCAAATAGTTTTAGACCCGACTTTCT
TTATGTGGTACATAGAGATGATAATATTTCGATTGTTGCTCAAAGCAAGGCAGGTGTGGGATTGCTTTATCAAGGGCTGA
CAATTCGGGGAATTGTTATGATTGCGATAATGGTTGTATTCAGCCTTTTATGCGCGTATATCTTTGCGCGGCAAATGACA
ACGCCGATCAAAGCCTTAGCGGACAGTGCGAATAAAATGGCAAACCTGAAAGATGTACCGCCGCCGCTGGAGCGAAAGGA
TGAGCTTGGCGCACTGGCTCATGATATGCATTCCATGTATGTCAGGCTGAAAGAAACCATCGCAAGGCTGGAGGATGAAA
TCGCAAGGCTGGAGGATGAAATCGCAAGGGAACATGAGTTGGAGGAAACACAGCGATATTTCTTTGCGGCAGCTTCTCAT
GAGCTAAAAACGCCCATCGCGGCTACAAGCGTTCTGTTGGAGGGAATGCTTGAAAATATCGGTGACTACAAAGATCATTC
TAAGTATCTGCGCGAATGCATCAAAATGATGGATAGGCAGGGCAAAATCATTTCCGAAATACTGGAGCTTGTCAGCCTGA
ATGATGGGAGAATCGTACCCATAGCTGAACCGTTGGACATAGGGCGCACGGTTGCCGAGTTGCTGCCCGATTTTCAAACC
TTGGCAGAGGCAAACAACCAGCGGTTCGTCACAGATATTCCAGCCGGGCAAATTGTCCTGTCCGATCCGAGGCTGCTCCA
AAAGGCACTATCCAATGTCATATTGAATGCAGTTCAGAACACGCCGCAGGGAGGCGAGGTACGGATATGGAGTGAGCCTG
GTGCTGAAAAATGCCGCCTTTTTGTTTTGAACATGGGCGTTCACATTGATGATACTGCGCTTCCAAGGCTGTTCACCCCA
TTCTATCGCATTGATCAGGCGCGAAGCAGAAAAAGTGGGCGAAGCGGTTTAGGACTTGCCATCGTACAAAAAACGCTGGA
TGCCATGAGCCTCCAGTATGCGCTGGAAAACACCTCGGATGGCGTTTTGTTCTGGCTGGATTTACCGCTCACATCAACAT
TGTAA

>>MEG_7495|Drugs|Glycopeptides|VanB-type_regulator|VANSB
ATGGAAAGAAAAGGGATTTTCATTAAGGTTTTTTCCTATACGATCATTGTCCTGCTACTGCTTGTCGGTGTAACAGCAAC
ACTGTTTGCACAGCAATTTGTGTCTTATTTCAGAGTGATGGAATTACAGCAAACAGTAAAATCCTATCAGCCATTGGTGG
AACTGATTCAGAATAGCGATAGGCTTGATATTCAAGAGGTGGCAGGGCTGTTTCACTACAATAACCAATCCTTTGAGTTT
TATATTGAAGATAAAGAGGGAAGCGTACTCTATGCCACACCAAATGCCAATACATCAAATAGTTTTAGACCCGACTTTCT
TTATGTGGTACATAGAGATGATAATATTTCGATTGTTGCTCAAAGCAAGGCAGGTGTGGGATTGCTTTATCAAGGGCTGA
CAATTCGGGGAATTGTTATGATTGCGATAATGGTTGTATTCAGCCTTTTATGCGCGTATATCTTTGCGCGGCAAATGACA
ACGCCGATCAAAGCCTTAGCGGACAGTGCGAATAAAATGGCAAACCTGAAAGATGTACCGCCGCCGCTGGAGCGAAAGGA
TGAGCTTGGCGCACTGGCTCATGATATGCATTCCATGTATGTCAGGCTGAAAGAAACCATCGCAAGGCTGGAGGATGAAA
TCGCAAGGGAACATGAGTTGGAGGAAACACAGCGATATTTCTTTGCGGCAGCTTCTCATGAGCTAAAAACGCCCATCGCG
GCTACAAGCGTTCTGTTGGAGGGAATGCTTGAAAATATCGGTGACTACAAAGATCATTCTAAGTATCTGCGCGAATGCAT
CAAAATGATGGATAGGCAGGGCAAAATCATTTCCGAAATACTGGAGCTTGTCAGCCTGAATGATGGGAGAATCGTACCCA
TAGCTGAACCGTTGGACATAGGGCGCACGGTTGCCGAGTTGCTGCCCGATTTTCAAACCTTGGCAGAGGCAAACAACCAG
CGGTTCGTCACAGATATTCCAGCCGGACAAATTGTCCTGTCCGATCCGAGGCTGCTCCAAAAGGCACTATCCAATGTCAT
ATTGAATGCAGTTCAGAACACGCCGCAGGGAGGCGAGGTACGGATATGGAGTGAGCCTGGTGCTGAAAAATGCCGCCTTT
TTGTTTTGAACATGGGCGTTCACATTGATGATACTGCGCTTCCAAGGCTGTTCACCCCATTCTATCGCATTGATCAGGCG
CGAAGCAGAAAAAGTGGGCGAAGTGGTTTAGGACTTGCCATCGTACAAAAAACGCTGGATGCCATGAGCCTCCAGTATGC
GCTGGAAAACACCTCGGATGGCGTTTTGTTCTGGCTGGATTTACCGCTCACATCAACATTGTAA

>>MEG_7496|Drugs|Glycopeptides|VanB-type_regulator|VANSB
ATGGAAAGAAAAGGGATTTTCATTAAGGTTTTTTCCTATACGATCATTGTCCTGCTACTGCTTGTCGGTGTAACAGCAAC
ACTGTTTGCACAGCAATTTGTGTCTTATTTCAGAGTGATGGAATTACAGCAAACAGTAAAATCCTATCAGCCATTGGTGG
AACTGATTCAGAATAGCGATAGGCTTGATATTCAAGAGGTGGCAGGGCTGTTTCACTACAATAACCAATCCTTTGAGTTT
TATATTGAAGATAAAGAGGGAAGCGTACTCTATGCCACACCAAATGCCAATACATCAAATAGTTTTAGACCCGACTTTCT
TTATGTGGTACATAGAGATGATAATATTTCGATTGTTGCTCAAAGCAAGGCAGGTGTGGGATTGCTTTATCAAGGGCTGA
CAATTCGGGGAATTGTTATGATTGCGATAATGGTTGTATTCAGCCTTTTATGCGCGTATATCTTTGCGCGGCAAATGACA
ACGCCGATCAAAGCCTTAGCGGACAGTGCGAATAAAATGGCAAACCTGAAAGATGTACCGCCGCCGCTGGAGCGAAAGGA
TGAGCTTGGCGCACTGGCTCATGATATGCATTCCATGTATGTCAGGCTGAAAGAAACCATCGCAAGGCTGGAGGATGAAA
TCGCAAGGGAACATGAGTTGGAGGAAACACAGCGATATTTCTTTGCGGCAGCTTCTCATGAGCTAAAAACGCCCATCGCG
GCTACAAGCGTTCTGTTGGAGGGAATGCTTGAAAATATCGGTGACTACAAAGATCATTCTAAGTATCTGCGCGAATGCAT
CAAAATGATGGATAGGCAGGGCAAAATCATTTCCGAAATACTGGAGCTTGTCAGCCTGAATGATGGGAGAATCGTACCCA
TAGCTGAACCGTTGGACATAGGGCGCACGGTTGCCGAGTTGCTGCCCGATTTTCAAACCTTGGCAGAGGCAAACAACCAG
CGGTTCGTCACAGATATTCCAGCCGGGCAAATTGTCCTGTCCGATCCGAGGCTGCTCCAAAAGGCACTATCCAATGTCAT
ATTGAATGCAGTTCAGAACACGCCGCAGGGAGGCGAGGTACGGATATGGAGTGAGCCTGGTGCTGAAAAATGCCGCCTTT
TTGTTTTGAACATGGGCGTTCACATTGATGATACTGCGCTTCCAAGGCTGTTCACCCCATTCTATCGCATTGATCAGGCG
CGAAGCAGAAAAAGTGGGCGAAGCGGTTTAGGACTTGCCATCGTACAAAAAACGCTGGATGCCATGAGCCTCCAGTATGC
GCTGGAAAACACCTCGGATGGCGTTTTGTTCTGGCTGGATTTACCGCTCACATCAACATTGTAA