MEGAResFrom MEG, the Microbial Ecology Group

Notice: Trying to access array offset on value of type null in /home/meglabuser/megares.meglab.org/vendor/doctrine/annotations/lib/Doctrine/Common/Annotations/DocParser.php on line 967

VANRB

The vanR gene encodes a response regulator that is part of the two-component sensor-kinase system. This gene is part of the VanB operon and is a regulator gene.

References

  • http://cid.oxfordjournals.org/content/42/Supplement_1/S25.full,http://www.readcube.com/articles/10.1038/ja.2013.117

Notice: Trying to access array offset on value of type null in /home/meglabuser/megares.meglab.org/vendor/doctrine/annotations/lib/Doctrine/Common/Annotations/DocParser.php on line 967

Other Groups in VanB-type regulator

Sequences

Download Sequences

>>MEG_7460|Drugs|Glycopeptides|VanB-type_regulator|VANRB
atgtcgatacgaattctacttgtcgaggatgatgatcatatctgtaatacagtaagggcgtttctggctgaggcaggata
tcaggtggatgcctgcacagatggaaatgaggcatacaccaagttttacgaaaacacttatcaactggttattcttgata
ttatgctgcccggtatgaacgggcatgaacttttgcgtgaatttcgtgcgaaaaatgatactcccattctgatgatgaca
gccctgtcggatgacgaaaaccaaatccgggcgtttgatgcagaggcagacgactatgtaacaaagccattcaagatgca
gattttactaaagcgggtggaagccctgctgcggcgcagcggtgcgctggcaaaggaaatccgtgtcggcaggctgacac
ttctgccggaggatttcacggtactttgtgacggtacagagctgcccctgacacgaaaagaatttgaaatccttttgctg
ctggtgcagaacaaaggcagaaccttaacgcatgaaatcattttgtcacgtatatggggatatgactttgagggtgatgg
cagcacagtccacactcatatcaaaaatttgcgggccaagctgccggaaaatatcatcaaaaccattcgcggtgtaggat
accgattggaggaatcattataa

>>MEG_7461|Drugs|Glycopeptides|VanB-type_regulator|VANRB
atgtcgatacgaattctacttgtcgaggatgatgatcatatctgtaatacagtaagggcgtttctggctgaggcaggata
tcaggtggatgcctgcacagatggaaatgaggcatacaccaagttttacgaaaacacttatcaactggttattcttgata
ttatgctgcccggtatgaacgggcatgaacttttgcgtgaatttcgtgcgaaaaatgatactcccattctgatgatgaca
gccctgtcggatgacgaaaaccaaatccgggcgtttgatgcagaggcagacgactatgtaacaaagccattcaagatgca
gattttactaaagcgggtggaagccctgctgcggcgcagcggtgcgctggcaaaggaaatccgtgtcggcaggctgacac
ttctgccggaggatttcacggtactttgtgacggtacagagctgcccctgacacgaaaagaatttgaaatccttttgctg
ctggtgcagaacaaaggcagaaccttaacgcatgaaatcattttgtcacgtatatggggatatgactttgagagtgatgg
cagcacagtccacactcatatcaaaaatttgcgggccaagctgccggaaaatatcatcaaaaccattcgcggtgtaggat
accgattggaggaatcataa

>>MEG_7462|Drugs|Glycopeptides|VanB-type_regulator|VANRB
ATGTCGATACGAATTCTACTTGTCGAGGATGATGATCATATCTGTAATACAGTAAGGGCGTTTCTGGCTGAGGCAGGATA
TCAGGTGGATGCCTGCACAGATGGAAATGAGGCATACACCAAGTTTTACGAAAACACTTATCAACTGGTTATTCTTGATA
TTATGCTGCCCGGTATGAACGGGCATGAACTTTTGCGTGAATTTCGTGCGAAAAATGATACTCCCATTCTGATGATGACA
GCCCTGTCGGATGACGAAAACCAAATCCGGGCGTTTGATGCAGAGGCAGACGACTATGTAACAAAGCCATTCAAGATGCA
GATTTTACTAAAGCGGGTGGAAGCCCTGCTGCGGCGCAGCGGTGCGCTGGCAAAGGAAATCCGTGTCGGCAGGCTGACAC
TTCTGCCGGAGGATTTCACGGTACTTTGTGACGGTACAGAGCTGCCCCTGACACGAAAAGAATTTGAAATCCTTTTGCTG
CTGGTGCAGAACAAAGGCAGAACCTTAACGCATGAAATCATTTTGTCACGTATATGGGGATATGACTTTGAGGGTGATGG
CAGCACAGTCCACACTCATATCAAAAATTTGCGGGCCAAGCTGCCGGAAAATATCATCAAAACCATTCGCGGTGTAGGAT
ACCGATTGGAGGAATCATAA

>>MEG_7463|Drugs|Glycopeptides|VanB-type_regulator|VANRB
ATGAATAGAATAAAAGTCGCAATCATCTTCGGCGGTTGCTCGGAGGAACATGATGTGTCGGTAAAATCCGCAATAGAAAT
TGCTGCGAACATTGATACGGAAAAATTCGATCCGCACTACATCGGAATTACAAAAAACGGTGTATGGAAGCTATGCAAGA
AGCCATGTACGGAATGGGAAGCCGACAGTCTCCCCGCCATACTCTCCCCGGATAGGAAAACGCATGGGCTGCTTGTCATG
AAAGAAAGCGAATACGAAACACGGCGTATTGATGTGGCTTTCCCGGTTTTGCATGGCAAATGCGGGGAGGATGGTGCGAT
ACAGGGGCTGTTTGTATTGTCTGGTATCCCCTATGTGGGCTGTGATATTCAAAGCTCCGCAGCTTGCATGGACAAATCAC
TGGCCTACATTCTTACAAAAAATGCGGGCATCGCCGTTCCCGAATTTCAAATGATTGATAAAGGTGACAAGCCGGAGGCG
GGTGCGCTTACCTACCCTGTCTTTGTGAAGCCGGCACGGTCAGGTTCGTCCTTTGGCGTAACCAAAGTAAACGGTACGGA
AGAACTTAACGCTGCGATAGAAGCGGCAGGACAATATGATGGAAAAATCTTAATTGAGCAAGCGATTTCGGGCTGTGAGG
TCGGGTGTGCGGTCATGGGGAACGAGGATGATTTGATTGTCGGCGAAGTGGATCAAATCCGGCTGAGCCACGGTATCTTC
CGCATCCATCAGGAAAACGAGCCGGAAAAAGGCTCAGAAAATGCGATGATTACAGTTCCCGCAGACATTCCGGTCGAGGA
ACGAAATCGGGTGCAGGAAACGGCAAAGAAAGTATATCGGGTGCTTGGATGCAGAGGGCTTGCCCGTGTTGATCTTTTTT
TGCAGGAGGATGGCGGCATCGTTCTAAATGAGGTCAATACCCTGCCCGGTTTTACATCGTACAGCCGCTACCCACGTATG
ATGGCCGCCGCAGGAATCACGCTTCCTGCACTGATTGACAGCCTGATTACATTGGCGTTAAAGAGGTGA

>>MEG_7464|Drugs|Glycopeptides|VanB-type_regulator|VANRB
ATGTCGATACGAATTCTACTTGTCGAGGATGATGATCATATCTGCAATACAGTAAGGGCGTTTTTGGCTGAAGCAAGATA
TGAGGTGGATGCCTGCACAGATGGAAACGAAGCACACACCAAGTTCTATGAAAACACCTATCAACTGGTTATTCTTGATA
TTATGCTGCCCGGTATGAATGGGCATGAACTTCTACGTGAATTTCGGGCGCAAAATGATACCCCCATTCTGATGATGACA
GCCCTGTCGGATGACGAAAACCAAATCCGGGCGTTTGATGCAGAGGCAGACGACTATGTAACAAAGCCATTCAAGATGCG
GATTTTACTAAAGCGGGTGGAAGCCCTGTTACGGCGCAGCGGTGCGCTGGCAAAGGAATTTCGTGTGGGCAGGCTGACAC
TTCTGCCGGAGGATTTTAGGGTACTTTGTGACGGTACGGAGCTGCCCCTGACACGAAAAGAATTTGAAATCCTTTTGCTG
CTGGTGCAGAACAAAGGCAGAACCTTAACCCATGAAATCATTTTGTCCCGCATATGGGGATATGACTTTGACGGTGATGG
CAGCACAGTCCACACTCATATCAAAAATCTGCGGGCGAAGCTGCCGGAAAATATCATCAAAACCATCCGCGGTGTAGGTT
ACCGATTGGAGGAATCATTATAA

>>MEG_7465|Drugs|Glycopeptides|VanB-type_regulator|VANRB
ATGGAAAAAAGCAACTATCATTCCAATGTGAATCATCACAAACGGCATATGAAACAATCTGGGGAAAAACGGGCTTTTCT
ATGGGCGTTCATTATCTCGTTCACAGTCTGCACGCTGTTTTTGGGGTGGAGATTGGTTTCCGTATTGGAGGCAACACAGC
TACCGCCCATCCCTGCAACTCATACAGGCAGCGGGACTGGTGTAGCGGAGAATCCAGAGGAAAACACTCTTGCCACCGCC
AAAGAACAGGGAGATGAACAGGAATGGAGCCTGATTTTAGTGAACAGGCAGAACCCCATCCCCGCCCAGTACGATGTGGA
ACTTGAGCAGCTGTCAAATGGTGAGCGGATAGACATTCGGATTTCTCCCTACCTCCAGGATTTGTTTGATGCCGCAAGAG
CTGATGGAGTTTACCCGATTGTCGCATCCGGATACCGGACAACAGAAAAACAGCAAGAAATCATGGATGAAAAAGTCGCC
GAATACAAGGCGAAAGGCTACACCTCTGCACAGGCTAAAGCGGAAGCAGAAACTTGGGTGGCCGTGCCGGGAACAAGCGA
GCATCAGCTTGGTCTTGCTGTGGATATCAATGCGGATGGAATTCATTCAACCGGCAACGAGGTTTACAGATGGCTGGATG
AAAACAGCTATCGCTTTGGTTTTATTCGCCGCTACCCGCCAGACAAGACAGAGATAACCGGTGTGAGCAACGAGCCGTGG
CATTACCGATATGTCGGCATCGAAGCTGCCACAAAGATATACCACCAAGGGCTTTGCCTTGAGGAATATTTAAACACAGA
AAAATGA

>>MEG_7466|Drugs|Glycopeptides|VanB-type_regulator|VANRB
ATGAACAGAAAAAGATTGACACAGCGCTTCCCGTTCCTGCTTCCAATGAGACAAGCGCAGAGAAAAATATGCTTTTATGC
GGGAATGAGATTTGACGGCTGTTGCTATGCACAGACGATAGGAGAAAAAACGCTTCCCTATTTGCTCTTTGAAACGGATT
GTGCGTTATACAACCACAATACCGGATTTGACATGATATACCAAGAAAACAAGGTGTTCAACTTAAAGCTGGCGGCAAAG
ACCTTAAACGGCCTATTGATAAAACCGGGGGAAACCTTTTCTTTCTGGCGGCTGGTACGCCATGCGGACAAAGATACCCC
CTATAAAGACGGCCTTACGGTGGCCAATGGTAAGCTCACCACCATGTCGGGCGGCGGTATGTGCCAGATGAGCAATTTAC
TATTTTGGGTGTTCCTGCATACGCCATTGACAATTATCCAGCGCAGCGGTCACGTAGTAAAGGAGTTTCCAGAGCCAAAC
AGTGACGAGATCAAAGGGGTGGATGCAACCATCTCAGAGGGCTGGATTGATTTAAAAGTGCGAAACGATACCGACTGCAC
CTACCAAATATGGGTGACCCTAGATGATGAGAAAATCATCGGTCAGGTGTTCGCCGACAAACAGCCTCAAGCATTATACA
AAATTGCAAACGGCAGTATTCAGTATGTCCGTGAAAGTGGCGGGATTTATGAATATGCCAAGGTTGAACGGATGCAAGTT
GCCTTAGGTACCGGGGAAATAATAGATTGCAAGCTGCTTTATACAAACAAATGCAAAATCTGCTATCCCCTCCCGGAAAG
TGTGGATATTCAGGAGGCGAACCAATGA

>>MEG_7467|Drugs|Glycopeptides|VanB-type_regulator|VANRB
ATGGAAAATGGTTTTTTGTTTTTAGATGAAATGTTGCATGGTGTTCGTTGGGATGCCAAGTACGCTACATGGGATAACTT
CACGGGAAAACCAGTGGATGGGTATGAGGTGAATCGCATCATCGGCACAAAGGCCGTGGCGCTTGCTCTGCGCGAAGCAC
AAATCCATGCGGCACGCCTTGGCTACGGCTTGCTTTTATGGGATGGATATCGGCCAAAATCTGCGGTGGACTGTTTCCTG
CGTTGGGCGGCGCAGCCGGAGGACAACCTCACAAAAGAAAAATATTACCCCAATATTGAGCGAGCCGAGTTGATTACAAA
GGGCTATGTGGCCTCACAATCCAGCCATAGCCGTGGAAGCACAATTGATCTTACGCTCTACCACTTGGATACAGGGGAAC
TTGTTTCAATGGGAAGCAACTTCGATTTTATGGACGAACGGTCGCACCATACAGCAAAAGGGATAGGGAATGCAGAGGCA
CAAAATCGAAGATGCTTGCGTAAAATCATGGAAAGCAGCGGATTTCAGTCCTATCGCTTTGAATGGTGGCACTATAAGTT
GATTGATGAGCCATACCCCGATACCTATTTTAATTTTGCTGTTTCATAA

>>MEG_7468|Drugs|Glycopeptides|VanB-type_regulator|VANRB
ATGGAAAGAAAAGGGATTTTCATTAAGGTTTTTTCCTATACGATCATTGTCCTGTTACTGCTTGTCGGTGTAACGGCAAC
ACTGTTTGCACAGCAATTTGTGTCTTATTTCAGAGCGATGGAAGCACAGCAAACAGTAAAATCCTATCAGCCATTGGTGG
AACTGATTCAGAATAGCGATAGGCTTGATATGCAAGAGGTGGCAGGGCTGTTTCACTACAATAACCAATCCTTTGAGTTT
TATATTGAAGATAAAGAGGGAAGCGTACTCTATGCCACACCGAATGCCGATACATCAAATAGTGTTAGGCCCGACTTTCT
TTATGTGGTACATAGAGATGATAATATTTCGATTGTTGCTCAAAGCAAGGCAGGTGTGGGATTGCTTTATCAAGGGCTGA
CAATTCGGGGAATTGTTATGATTGCGATAATGGTTGTATTCAGCCTTTTATGCGCGTATATCTTTGCGCGGCAAATGACA
ACGCCGATCAAAGCCTTAGCGGACAGTGCGAATAAAATGGCAAACCTGAAAGAAGTACCGCCGCCGCTGGAGCGAAAGGA
TGAGCTTGGCGCACTGGCTCACGACATGCATTCCATGTATATCAGGCTGAAAGAAACCATCGCAAGGCTGGAGGATGAAA
TCGCAAGGGAACATGAGTTGGAGGAAACACAGCGATATTTCTTTGCGGCAGCCTCTCATGAGTTAAAAACGCCCATCGCG
GCTGTAAGCGTTCTGTTGGAGGGAATGCTTGAAAATATCGGTGACTACAAAGACCATTCTAAGTATCTGCGCGAATGCAT
CAAAATGATGGACAGGCAGGGCAAAACCATTTCCGAAATACTGGAGCTTGTCAGCCTGAACGATGGGAGAATCGTACCCA
TAGCCGAACCGCTGGACATAGGGCGCACGGTTGCCGAGCTGCTACCCGATTTTCAAACCTTGGCAGAGGCAAACAACCAG
CGGTTCGTCACAGATATTCCAGCCGGACAAATTGTCCTGTCCGATCCGAAGCTGATCCAAAAGGCGCTATCCAATGTCAT
ATTGAATGCGGTTCAGAACACGCCCCAGGGAGGTGAGGTACGGATATGGAGTGAGCCTGGGGCTGAAAAATACCGTCTTT
CCGTTTTGAACATGGGCGTTCACATTGATGATACTGCACTTTCAAAGCTGTTCATCCCATTCTATCGCATTGATCAGGCG
CGAAGCAGAAAAAGTGGGCGAAGCGGTTTGGGGCTTGCCATCGTACAAAAAACGCTGGATGCCATGAGCCTCCAATATGC
GCTGGAAAACACCTCAGATGGCGTTTTGTTCTGGCTGGATTTACCGCCCACATCAACACTATAA

>>MEG_7469|Drugs|Glycopeptides|VanB-type_regulator|VANRB
ATGTCGATACGAATTCTACTTGTCGAGGATGATGATCATATCTGTAATACAGTAAGGGGGTTTCTGGCTGAGGCAGGATA
TCAGGTGGATGCCTGCACAGATGGAAATGAGGCATACACCAAGTTTTACGAAAACACCTATCAACTGGTTATTCTTGATA
TTATGCTGCCCGGTATGAACGGGCATGAACTTTTGCGTGAATTTCGTGCGAAAAATGATACTCCCATTCTGATGATGACA
GCCCTGTCGGATGACGAAAACCAAATCCGGGCGTTTGATGCAGAGGCAGACGACTATGTAACAAAGCCATTCAAGATGCA
GATTTTACTAAAGCGGGTGGAAGCCCTGTTACGGCGCAGCGGTGCGCTGGCAAAGGAAATCCGTGTCGGCAGGCTGACAC
TTCTGCCGGAGGATTTCACGGTACTTTGTGACGGTACAGAGCTGCCCCTGACACGAAAAGAATTTGAAATCCTTTTGCTG
CTGGTGCAGAACAAAGGCAGAACCTTAACGCATGAAATCATTTTGTCACGTATATGGGGATATGACTTTGAGGGTGATGG
CAGCACAGTCCACACTCATATCAAAAATTTGCGGGCCAAGCTGCCGGAAAATATCATCAAAACCATTCGCGGTGTAGGAT
ACCGATTGGAGGAATCATTATAA