MEGAResFrom MEG, the Microbial Ecology Group

Notice: Trying to access array offset on value of type null in /home/meglabuser/megares.meglab.org/vendor/doctrine/annotations/lib/Doctrine/Common/Annotations/DocParser.php on line 967

VANRA

The vanR gene encodes a response regulator that is part of the two-component sensor-kinase system. This gene is part of the VanA operon and is a regulator gene.

References

  • http://cid.oxfordjournals.org/content/42/Supplement_1/S25.full,http://www.readcube.com/articles/10.1038/ja.2013.117

Notice: Trying to access array offset on value of type null in /home/meglabuser/megares.meglab.org/vendor/doctrine/annotations/lib/Doctrine/Common/Annotations/DocParser.php on line 967

Other Groups in VanA-type regulator

Sequences

Download Sequences

>>MEG_7449|Drugs|Glycopeptides|VanA-type_regulator|VANRA
ttgagcaataaaattcttgttgtagacgatgaacatgatattgctgatttggttgagctatacttgaaaaacgagaatta
tacggttttcaaatactataccgctaaagaagcgttggattgtatagacaagaccgagcttgaccttgccatattggaca
tcatgcttcccggtgcaagtggcctttctatctgccaaaaaataagggacaagtatacctatcccattatcatgctgacc
gcgaaagattcggagatagataaaattacagggctaaccatcggcgcagacgattatataacgaagccctttcgcccgct
ggagttaattgcacgggttaaggcacagttgcgccgatacaaaaaatacagtggagtaacggagcagaacgaaaatatta
tcgtccactccggccttgtcattaatataaacacgcatgagtgttttctgaatgagaagccgttatccctcactcccacc
gagttttcaatcctgcgcatcctctgtgaaaacaaggggaatgtggttagctccgagcagatatttcatgagatatgggg
agaagaatatttcaacaagagcaacaacaccatcacggtgcatatccggcatctgcgcgaaaaaatgaacgccaccattg
ataatccgaaatatataaaaacggtatggggggttggctataaaattgaaaaataa

>>MEG_7450|Drugs|Glycopeptides|VanA-type_regulator|VANRA
ATGAGCGATAAAATACTTGTTGTGGACGATGAACATGAAATTGCCGATTTGGTTGAGCTATACTTGAAAAACGAGAATTA
TACGGTTTTCAAATACTATACCGCCAAAGAAGCGTTGGAATGTATAGACAAGACCGATCTTGACCTTGCCATATTGGACA
TCATGCTTCCCGGCGCAAGCGGCCTCGCTATCTGCCAAAAAATAAGGGACAAGCACACCTATCCAATTATCACGCTGACC
GCGAAAGATACGGAGGTAGATAAAATTACAGGGCTAACAATCGGCGCGGACGATTATATAACGAAGCCCTTTCGCCCGCT
GGAGTTAATTGCGCGGGTCAAGGCGCAGTTGCGCCGATACAAAAAATACAATGGAGTAACGGAGCAGAACGAAAATGTTA
TCGTCCACTCCGGCCTTGTCATTAATATAAACACGCATGAGTGTTTTCTGAACGAGAAGCAGTTATCCCTCACTCCCACC
GAGTTTTCAATCCTGCGCATCCTCTGTGAAAACAAGGGGAATGTGGTTAGCTCCGAGCAGTTATTTCATGAGATATGGGG
CGACGAATATTTCAGCAAGAGCAACAACACCATCACCGTGCATATCCGGCATCTGCGCGAAAAAATGAACGACACCATTG
ATAATCCGAAGTATATAAAAACGGTATGGGGGGTTGGCTATAAAATTGAAAAATAA

>>MEG_7451|Drugs|Glycopeptides|VanA-type_regulator|VANRA
ATGAGCGATAAAATACTTATTGTGGATGATGAACATGAAATTGCCGATTTGGTTGAATTATACTTAAAAAACGAGAATTA
TACGGTTTTCAAATACTATACCGCCAAAGAAGCATTGGAATGTATAGACAAGTCTGAGATTGACCTTGCCATATTGGACA
TCATGCTTCCCGGCACAAGCGGCCTTACTATCTGTCAAAAAATAAGGGACAAGCACACCTATCCGATTATCATGCTGACC
GGGAAAGATACAGAGGTAGATAAAATTACAGGGTTAACAATCGGCGCGGATGATTATATAACGAAGCCCTTTCGCCCACT
GGAGTTAATTGCTCGGGTAAAGGCCCAGTTGCGCCGATACAAAAAATTCAGTGGAGTAAAGGAGCAGAACGAAAATGTTA
TCGTCCACTCCGGCCTTGTCATTAATGTTAACACCCATGAGTGTTATCTGAACGAGAAGCAGTTATCCCTTACTCCCACC
GAGTTTTCAATACTGCGAATCCTCTGTGAAAACAAGGGGAATGTGGTTAGCTCCGAGCTGCTATTTCATGAGATATGGGG
CGACGAATATTTCAGCAAGAGCAACAACACCATCACCGTGCATATCCGGCATTTGCGCGAAAAAATGAACGACACCATTG
ATAATCCGAAATATATAAAAACGGTATGGGGGGTTGGCTATAAAATTGAAAAATAA

>>MEG_7452|Drugs|Glycopeptides|VanA-type_regulator|VANRA
TTGGGAAAAATATTATCTAGAGGATTGCTAGCTTTATATTTAGTGACACTAATCTGGTTAGTGTTATTCAAATTACAATA
CAATATTTTATCAGTATTTAATTATCATCAAAGAAGTCTTAACTTGACTCCATTTACTGCTACTGGGAATTTCAGAGAGA
TGATAGATAATGTTATAATCTTTATTCCATTTGGCTTGCTTTTGAATGTCAATTTTAAAGAAATCGGATTTTTACCTAAG
TTTGCTTTTGTACTGGTTTTAAGTCTTACTTTTGAAATAATTCAATTTATCTTCGCTATTGGAGCGACAGACATAACAGA
TGTAATTACAAATACTGTTGGAGGCTTTCTTGGACTGAAATTATATGGTTTAAGCAATAAGCATATGAATCAAAAAAAAT
TAGACAGAGTTATTATTTTTGTAGGTATACTTTTGCTCGTATTATTGCTCGTTTACCGTACCCATTTAAGAATAAATTAC
GTGTAA

>>MEG_7453|Drugs|Glycopeptides|VanA-type_regulator|VANRA
ATGAGCGATAAAATACTTATTGTGGATGATGAACATGAAATTGCCGATTTGGTTGAATTATACTTAAAAAACGAGAATTA
TACGGTTTTCAAATACTATACCGCCAAAGAAGCATTGGAATGTATAGACAAGTCTGAGATTGACCTTGCCATATTGGACA
TCATGCTTCCCGGCACAAGCGGCCTTACTATCTGTCAAAAAATAAGGGACAAGCACACCTATCCGATTATCATGCTGACC
GGGAAAGATACAGAGGTAGATAAAATTACAGGGTTAACAATCGGCGCGGATGATTATATAACGAAGCCCTTTCGCCCACT
GGAGTTAATTGCTCGGGTAAAGGCCCAGTTGCGCCGATACAAAAAATTCAGTGGAGTAAAGGAGCAGAACGAAAATGTTA
TCGTCCACTCCGGCCTTGTCATTAATGTTAACACCCATGAGTGTTATCTGAACGAGAAGCAGTTATCCCTTACTCCCACC
GAGTTTTCAATACTGCGAATCCTCTGTGAAAACAAGGGGAATGTGGTTAGCTCCGAGCTGCTATTTCATGAGATATGGGG
CGACGAATATTTCAGCAAGAGCAACAACACCATCACCGTGCATATCCGGCATTTGCGCGAAAAAATGAACGACACCATTG
ATAATCCGAAATATATAAAAACGGTATGGGGGGTTGGTTATAAAATTGAAAAATAA

>>MEG_7454|Drugs|Glycopeptides|VanA-type_regulator|VANRA
TTGGTTATAAAATTGAAAAATAAAAAAAACGACTATTCCAAACTAGAACGAAAACTTTACATGTATATCGTTGCAATTGT
TGTGGTAGCAATTGTATTCGTGTTGTATATTCGTTCAATGATCCGAGGGAAACTTGGGGATTGGATCTTAAGTATTTTGG
AAAACAAATATGACTTAAATCACCTGGACGCGATGAAATTATATCAATATTCCATACGGAACAATATAGATATCTTTATT
TATGTGGCGATTGTCATTAGTATTCTTATTCTATGTCGCGTCATGCTTTCAAAATTCGCAAAATACTTTGACGAGATAAA
TACCGGCATTGATGTACTTATTCAGAACGAAGATAAACAAATTGAGCTTTCTGCGGAAATGGATGTTATGGAACAAAAGC
TCAACACATTAAAACGGACTCTGGAAAAGCGAGAGCAGGATGCAAAGCTGGCCGAACAAAGAAAAAATGACGTTGTTATG
TACTTGGCGCACGATATTAAAACGCCCCTTACATCCATTATCGGTTATTTGAGCCTGCTTGACGAGGCTCCAGACATGCC
GGTAGATCAAAAGGCAAAGTATGTGCATATCACGTTGGACAAAGCGTATCGACTCGAACAGCTAATCGACGAGTTTTTTG
AGATTACACGGTATAACCTACAAACGATAACGCTAACAAAAACGCACATAGACCTATACTATATGCTGGTGCAGATGACC
GATGAATTTTATCCTCAGCTTTCCGCACATGGAAAACAGGCGGTTATTCACGCCCCCGAGGATCTGACCGTGTCCGGCGA
CCCTGATAAACTCGCGAGAGTCTTTAACAACATTTTGAAAAACGCCGCTGCATACAGTGAGGATAACAGCATCATTGACA
TTACCGCGGGCCTCTCCGGGGATGTGGTGTCAATCGAATTCAAGAACACTGGAAGCATCCCAAAAGATAAGCTAGCTGCC
ATATTTGAAAAGTTCTATAGGCTGGACAATGCTCGTTCTTCCGATACGGGTGGCGCGGGACTTGGATTGGCGATTGCAAA
AGAAATTATTGTTCAGCATGGAGGGCAGATTTACGCGGAAAGCAATGATAACTATACGACGTTTAGGGTAGAGCTTCCAG
CGATGCCAGACTTGGTTGATAAAAGGAGGTCCTAA

>>MEG_7455|Drugs|Glycopeptides|VanA-type_regulator|VANRA
ATGAATAACATCGGCATTACTGTTTATGGATGTGAGCAGGATGAGGCAGATGCATTCCATGCTCTTTCGCCTCGCTTTGG
CGTTATGGCAACGATAATTAACGCCAACGTGTCGGAATCCAACGCCAAATCCGCGCCTTTCAATCAATGTATCAGTGTGG
GACATAAATCAGAGATTTCCGCCTCTATTCTTCTTGCGCTGAAGAGAGCCGGTGTGAAATATATTTCTACCCGAAGCATC
GGCTGCAATCATATAGATACAACTGCTGCTAAGAGAATGGGCATCACTGTCGACAATGTGGCGTACTCGCCGGATAGCGT
TGCCGATTATACTATGATGCTAATTCTTATGGCAGTACGCAACGTAAAATCGATTGTGCGCTCTGTGGAAAAACATGATT
TCAGGTTGGACAGCGACCGTGGCAAGGTACTCAGCGACATGACAGTTGGTGTGGTGGGAACGGGCCAGATAGGCAAAGCG
GTTATTGAGCGGCTGCGAGGATTTGGATGTAAAGTGTTGGCTTATAGTCGCAGCCGAAGTATAGAGGTAAACTATGTACC
GTTTGATGAGTTGCTGCAAAATAGCGATATCGTTACGCTTCATGTGCCGCTCAATACGGATACGCACTATATTATCAGCC
ACGAACAAATACAGAGAATGAAGCAAGGAGCATTTCTTATCAATACTGGGCGCGGTCCACTTGTAGATACCTATGAGTTG
GTTAAAGCATTAGAAAACGGGAAACTGGGCGGTGCCGCATTGGATGTATTGGAAGGAGAGGAAGAGTTTTTCTACTCTGA
TTGCACCCAAAAACCAATTGATAATCAATTTTTACTTAAACTTCAAAGAATGCCTAACGTGATAATCACACCGCATACGG
CCTATTATACCGAGCAAGCGTTGCGTGATACCGTTGAAAAAACCATTAAAAACTGTTTGGATTTTGAAAGGAGACAGGAG
CATGAATAG

>>MEG_7456|Drugs|Glycopeptides|VanA-type_regulator|VANRA
ATGAATAGAATAAAAGTTGCAATACTGTTTGGGGGTTGCTCAGAGGAGCATGACGTATCGGTAAAATCTGCAATAGAGAT
AGCCGCTAACATTAATAAAGAAAAATACGAGCCGTTATACATTGGAATTACGAAATCTGGTGTATGGAAAATGTGCGAAA
AACCTTGCGCGGAATGGGAAAACGACAATTGCTATTCAGCTGTACTCTCGCCGGATAAAAAAATGCACGGATTACTTGTT
AAAAAGAACCATGAATATGAAATCAACCATGTTGATGTAGCATTTTCAGCTTTGCATGGCAAGTCAGGTGAAGATGGATC
CATACAAGGTCTGTTTGAATTGTCCGGTATCCCTTTTGTAGGCTGCGATATTCAAAGCTCAGCAATTTGTATGGACAAAT
CGTTGACATACATCGTTGCGAAAAATGCTGGGATAGCTACTCCCGCCTTTTGGGTTATTAATAAAGATGATAGGCCGGTG
GCAGCTACGTTTACCTATCCTGTTTTTGTTAAGCCGGCGCGTTCAGGCTCATCCTTCGGTGTGAAAAAAGTCAATAGCGC
GGACGAATTGGACTACGCAATTGAATCGGCAAGACAATATGACAGCAAAATCTTAATTGAGCAGGCTGTTTCGGGCTGTG
AGGTCGGTTGTGCGGTATTGGGAAACAGTGCCGCGTTAGTTGTTGGCGAGGTGGACCAAATCAGGCTGCAGTACGGAATC
TTTCGTATTCATCAGGAAGTCGAGCCGGAAAAAGGCTCTGAAAACGCAGTTATAACCGTTCCCGCAGACCTTTCAGCAGA
GGAGCGAGGACGGATACAGGAAACGGCAAAAAAAATATATAAAGCGCTCGGCTGTAGAGGTCTAGCCCGTGTGGATATGT
TTTTACAAGATAACGGCCGCATTGTACTGAACGAAGTCAATACTCTGCCCGGTTTCACGTCATACAGTCGTTATCCCCGT
ATGATGGCCGCTGCAGGTATTGCACTTCCCGAACTGATTGACCGCTTGATCGTATTAGCGTTAAAGGGGTGA

>>MEG_7457|Drugs|Glycopeptides|VanA-type_regulator|VANRA
ATGGAAATAGGATTTACTTTTTTAGATGAAATAGTACACGGTGTTCGTTGGGACGCTAAATATGCCACTTGGGATAATTT
CACCGGAAAACCGGTTGACGGTTATGAAGTAAATCGCATTGTAGGGACATACGAGTTGGCTGAATCGCTTTTGAAGGCAA
AAGAACTGGCTGCTACCCAAGGGTACGGATTGCTTCTATGGGACGGTTACCGTCCTAAGCGTGCTGTAAACTGTTTTATG
CAATGGGCTGCACAGCCGGAAAATAACCTGACAAAGGAAAGTTATTATCCCAATATTGACCGAACTGAGATGATTTCAAA
AGGATACGTGGCTTCAAAATCAAGCCATAGCCGCGGCAGTGCCATTGATCTTACGCTTTATCGATTAGACACGGGTGAGC
TTGTACCAATGGGGAGCCGATTTGATTTTATGGATGAACGCTCTCATCATGCGGCAAATGGAATATCATGCAATGAAGCG
CAAAATCGCAGACGTTTGCGCTCCATCATGGAAAACAGTGGGTTTGAAGCATATAGCCTCGAATGGTGGCACTATGTATT
AAGAGACGAACCATACCCCAATAGCTATTTTGATTTCCCCGTTAAATAA

>>MEG_7458|Drugs|Glycopeptides|VanA-type_regulator|VANRA
ATGAAGAAGTTGTTTTTTTTATTGTTATTGTTATTCTTAATATACTTAGGTTATGACTACGTTAATGAAGCACTGTTTTC
TCAGGAAAAAGTCGAATTTCAAAATTATGATCAAAATCCCAAAGAACATTTAGAAAATAGTGGGACTTCTGAAAATACCC
AAGAGAAAACAATTACAGAAGAACAGGTTTATCAAGGAAATCTGCTATTAATCAATAGTAAATATCCTGTTCGCCAAGAA
AGTGTGAAGTCAGATATCGTGAATTTATCTAAACATGACGAATTAATAAATGGATACGGGTTGCTTGATAGTAATATTTA
TATGTCAAAAGAAATAGCACAAAAATTTTCAGAGATGGTCAATGATGCTGTAAAGGGTGGCGTTAGTCATTTTATTATTA
ATAGTGGCTATCGAGACTTTGATGAGCAAAGTGTGCTTTACCAAGAAATGGGGGCTGAGTATGCCTTACCAGCAGGTTAT
AGTGAGCATAATTCAGGTTTATCACTAGATGTAGGATCAAGCTTGACGAAAATGGAACGAGCCCCTGAAGGAAAGTGGAT
AGAAGAAAATGCTTGGAAATACGGGTTCATTTTACGTTATCCAGAGGACAAAACAGAGTTAACAGGAATTCAATATGAAC
CATGGCATATTCGCTATGTTGGTTTACCACATAGTGCGATTATGAAAGAAAAGAATTTCGTTCTCGAGGAATATATGGAT
TACCTAAAAGAAGAAAAAACCATTTCTGTTAGTGTAAATGGGGAAAAATATGAGATCTTTTATTATCCTGTTACTAAAAA
TACCACCATTCATGTGCCGACTAATCTTCGTTATGAGATATCAGGAAACAATATAGACGGTGTAATTGTGACAGTGTTTC
CCGGATCAACACATACTAATTCAAGGAGGTAA

>>MEG_7459|Drugs|Glycopeptides|VanA-type_regulator|VANRA
ATGAGCGATAAAATACTTGTTGTGGACGATGAACATGAAATTGCCGATTTGGTTGAGCTATACTTGAAAAACGAGAATTA
TACGGTTTTCAAATACTATACCGCCAAAGAAGCGTTGGAATGTATAGACAAGACCGATCTTGACCTTGCCATATTGGACA
TCATGCTTCCCGGCGCAAGCGGCCTCGCTATCTGCCAAAAGATAAGGGACAAGCACACCTATCCAATTATCATGCTGACC
GCGAAAGATACGGAGGTAGATAAAATTACAGGGCTAACAATCGGCGCGGACGATTATATAACGAAGTCCTTTCGCCCGCT
GGAGTTAATTGCGAGGGTCAAGGCGCAGTTGCGCCGATACAAAAAATACAGTGGAGTAGCGGAGCAGAACGAAAATGTTA
TCGTCCACTCCGGCCTTGTCATTAATATAAACACGCATGAGTGTTTTCTGAACGAGAAGCAGTTATCACTCACTCCCACC
GAGTTTTCAATCCTGCGCATCCTCTGTGAAAACAAGGGGAATGTGGTTAGCTCCGAGCAGTTATTTCATGAGATATGGGG
CGACGAATATTTCAGCAAGAGCAACAACACCATCACCGTGCATATCCGGCATCTGCGCGAAAAAATGAACGACACCATTG
ATAATCCGAAGTATATAAAAACGGTATGGGGGGTTGGCTATAAAATTGAAAAATAA