MEGAResFrom MEG, the Microbial Ecology Group

Notice: Trying to access array offset on value of type null in /home/meglabuser/megares.meglab.org/vendor/doctrine/annotations/lib/Doctrine/Common/Annotations/DocParser.php on line 967

FOSA

The fosA gene encodes a glutathione transferase that catalyzes a reaction between the fosfomycin molecule and glutathione, rendering it ineffective as an antibiotic.

References

  • http://www.ncbi.nlm.nih.gov/pmc/articles/PMC2286755/

Notice: Trying to access array offset on value of type null in /home/meglabuser/megares.meglab.org/vendor/doctrine/annotations/lib/Doctrine/Common/Annotations/DocParser.php on line 967

Other Groups in Fosfomycin thiol transferases

Sequences

Download Sequences

>>MEG_2982|Drugs|Fosfomycin|Fosfomycin_thiol_transferases|FOSA
ttgaaagctacaggattcaatcatgtgacgattcgcgtatccgatttgtcccgatcgttgttattttacgaatcattgct
gggaatgaagctcgttcatcgcgggcgtctcgacgtttatttggaatggggaagcgcctggatatgtttgatcgaacgaa
gctgcgagtcttcggagaagccgagttacggcgttgaccatattgcattttctataacggaagaagatttccatgacgcg
gcggtcaagctgcaggggtcgggtgttcccatcgtcagggggccgctggagcggggaggcgggtacagcatcaactttct
cgatccggacggtactgagctggagctgtttacgggcagtttagcggaacgtatgaaggggtggtcctga

>>MEG_2983|Drugs|Fosfomycin|Fosfomycin_thiol_transferases|FOSA
ATGCTGCAGGGATTGAATCATCTGACGCTGGCGGTCAGCGATCTGGCGTCAAGCCTGGCGTTTTATCAGCGGTTACCTGG
AATGCGTCTGCACGCCCGTTGGGATAGCGGAGCATATCTTTCCTGCGGGGCGTTGTGGCTATGCTTGTCGCTGGATGCGC
AGCGGCGTAAAACGCCCGCTCAGGAAAGCGACTATACCCATTATGCTTTCAGCGTGGCGGAAGAGCACTTTGCCGAGGTG
GTCGCCCAGCTGGCGCACGCGGGGGCCGAAGTATGGAAAGACAACCGCAGCGAAGGGGCGTCGTACTATTTTCTCGACCC
TGACGGCCATAAGCTGGAACTGCATGTGGGTCATTTGGCACAGCGGCTGGCCGCCTGTCGGGAACGCCCGTACAAGGGGA
TGGTCTTTTTTGACTGA

>>MEG_2984|Drugs|Fosfomycin|Fosfomycin_thiol_transferases|FOSA
ATGCTTACCGGTCTCAATCACCTGACCCTGGCGGTCGCCGACCTGCCGGCCAGCATCGCCTTCTACCGCGATCTTCTCGG
CTTTCGCCTGGAAGCGCGCTGGGACCAGGGCGCCTATCTCGAACTGGGTTCGCTGTGGCTGTGCCTGTCCCGGGAGCCGC
AGTACGGCGGGCCGGCCGCGGACTACACGCACTACGCCTTCGGCATCGCCGCCGCGGATTTCGCCCGCTTCGCCGCGCAG
CTGCGCGCGCATGGCGTGCGCGAATGGAAGCAGAACCGCAGCGAGGGCGATTCGTTCTACTTCCTCGACCCGGACGGCCA
TCGCCTGGAGGCCCACGTCGGCGACCTGCGCAGCCGGCTCGCGGCGTGCCGGCAAGCGCCCTATGCGGGAATGCGTTTCG
CCGACTAG

>>MEG_2985|Drugs|Fosfomycin|Fosfomycin_thiol_transferases|FOSA
ATGCTGCAATCACTCAACCATCTGACCCTCGCGGTCAGCGACCTGCAAAAAAGCGTTACCTTCTGGCACGAGCTGCTGGG
GCTGACGCTGCACGCCCGCTGGAATACCGGGGCCTATCTTACCTGCGGCGATCTGTGGGTCTGCCTGTCCTATGACGAGG
CGCGCGGTTACGTGCCGCCGCAGGAGAGCGACTATACCCATTACGCGTTTACCGTTGCGGCGGAAGATTTTGAGCCGTTC
TCGCACAAGCTGGAGCAGGCGGGCGTTACCGTCTGGAAGCAAAACAAAAGTGAGGGGGCATCGTTCTATTTTCTCGACCC
GGACGGGCACAAGCTGGAGCTGCACGTGGGCAGCCTCGCCGCGCGGCTGGCGGCGTGCCGGGAGAAACCCTATGCCGGAA
TGGTCTTCACCTCAGACGAGGCTTGA

>>MEG_2986|Drugs|Fosfomycin|Fosfomycin_thiol_transferases|FOSA
ATGCTGCAGGGATTGAATCATCTGACGCTGGCGGTCAGCGATCTGGCGTCAAGCCTGGCATTTTATCAGCAGTTACCTGG
AATGCGCCTGCACGCCAGCTGGGATAGCGGAGCCTATCTCTCCTGTGGGGCGCTGTGGCTGTGCTTGTCGCTGGATGAGC
AGCGGCGTAAAACGCCCCCTCAGGAAAGCGACTATACCCACTACGCCTTCAGCGTGGCGGAAGAAGAGTTTGCCGGGGTG
GTGGCTCTGCTGGCGCAGGCGGGGGCTGAGGTATGGAAAGATAACCGCAGTGAAGGGGCGTCTTACTATTTTCTCGACCC
TGACGGCCATAAGCTGGAGCTGCATGTGGGGAATCTGGCGCAGCGGCTGGCCGCCTGTCGCGAACGCCCCTACAAGGGGA
TGGTCTTTTTTGATTGA

>>MEG_2987|Drugs|Fosfomycin|Fosfomycin_thiol_transferases|FOSA
ATGCTGAGTGGACTGAATCACCTGACCCTGGCAGTCAGCCAGCTGGCGCCGAGCGTGGCGTTTTATCAGCAGCTGCTGGG
CATGACGCTGCATGCCCGCTGGGACAGCGGGGCTTATCTCTCCTGCGGCGATTTGTGGCTGTGCCTGTCGCTGGATCCGC
AGCGGCGCGTTACTCCGCCGGAAGAGAGCGACTACACCCATTATGCGTTTAGTATTAGCGAAGCCGATTTTGCTAGCTTC
GCCGCCCGCCTTGAGGCTGCCGGCGTGGCGATCTGGAAGCTGAACCGTAGCGAAGGTGCCTCGCACTATTTCCTCGATCC
CGATGGCCATAAGCTGGAGCTGCACGTCGGCAGTCTCGCCCAGCGTCTGGCCGCCTGCCGCGAACAGCAGTATAAGGGGA
TGGTGTTTTTTGATCAGTGA

>>MEG_2988|Drugs|Fosfomycin|Fosfomycin_thiol_transferases|FOSA
ATGCTTCAATCTCTGAACCACTTAACGCTTGCTGTCAGTAATTTGCAAACTAGCCTGACCTTCTGGCGCGATTTGCTGGG
GTTGCAGCTACATGCTGAGTGGGATACTGGCGCTTACCTTACCTGTGGCGACCTTTGGGTCTGTCTTTCTTACGACGTAT
CCTGTAACTACGTGGCCCCGCAGGAATGTGACTATACCCACTACGCATTCAGCATCGCGCCAGAAGATTTTGAACCGTTC
TCGTATAAGCTGAAACAGGCGGGAGTGACGGTCTGGAAAGACAATAAAAGCGAAGGGCAATCTTTCTATTTTCTTGACCC
CGATGGCCACAAGCTGGAACTGCATGTGGGAGATTTAGCATCTCGACTGGCGCAGTGCCGGGAGAAGCCTTACTCTGGAA
TGCGTTTCGGGCCTGGAAAATAA

>>MEG_2989|Drugs|Fosfomycin|Fosfomycin_thiol_transferases|FOSA
ATGCTCAGCGGGCTTAATCACCTGACGCTCGCGGTGCGCGATGTGGCGCGAAGCCTTGCGTTTTACCAGTCGCTGCCGGG
GCTGCGACTGCATGCGCGCTGGGACGGCGGGGCATATCTTTCGTGCGGCTCTCTGTGGCTGTGTCTGTCGCTGGATGAAA
ATGCCGGTTCGCCTGCCGCGGACTACACGCATTATGCGTTTACCGTAAGTGAGGCGGATTTCCCGCAGGTAGTGGAAACA
CTGACCGCCGCGGGCGTAACGCCCTGGAAAACCAACCGCAGCGAGGGCGACTCCTGGTATTTTCTCGACCCGGACGGGCA
TCAGCTTGAGCTGCACGTCGGCAGCCTCGCCACCCGGCTCGCCGCCTGCCGCGCCGCGCCCTATAAAGGAATGCGGTTTT
ATGATTAA

>>MEG_2990|Drugs|Fosfomycin|Fosfomycin_thiol_transferases|FOSA
GTGAAAGCCGCCTTTCGGCGGCTATCTGAAAATGGGGAAAACTACTCCGTGCCGCCTTTAAGAAGGCAGCCACCAGCGGT
TTACGGTGAGCACGGCGTGGTTTATGTTCATGAAGTTACCGTACCACGTCTGGCGCAAAAAACAAAAGGGCACGTCATGC
TGCAATCACTCAACCATCTGACCCTCGCGGTCAGCGACCTGCAAAAAAGCGTTACCTTCTGGCACGAGTTGCTGGGGCTG
ACGCTGCACGCCCGCTGGAATACCGGGGCCTATCTTACCTGCGGCGATCTGTGGGTCTGCCTGTCCTATGACGAGGCGCG
CGGTTACGTGCCGCCGCAGGAGAGCGACTATACCCATTACGCGTTTACCGTTGCGGCGGAAGATTTTGAGCCGTTCTCGC
ACAAGCTGGAGCAGGCAGGCGTTACCGTCTGGAAGCAGAACAAAAGTGAGGGGGCATCGTTCTATTTTCTCGACCCGGAT
GGGCACAAGCTGGAGCTGCACGTGGGCAGCCTCGCCGCGCGGCTGGCGGCGTGCCGGGAGAAACCCTATGCCGGAATGGT
CTTCACCTCAGACGAGGCTTGA

>>MEG_2991|Drugs|Fosfomycin|Fosfomycin_thiol_transferases|FOSA
ATGCTGAGTGGACTGAATCACCTGACCCTGGCAGTCAGCCAGCTGGCGCCGAGCGTGGCGTTTTATCAGCAGCTACTGGG
CATGACGCTGCATGCCCGCTGGGACAGCGGGGCCTATCTTTCCTGTGGCGATCTGTGGCTGTGCCTGTCGCTGGATCCGC
AGCGGCGCGTTACTCCGCCGGAGGAGAGCGACTACACCCATTATGCGTTTAGCATTAGCGAGGCGGATTTCGCTAGCTTC
GCCGCCCGCCTTGAGGCTGCCGGCGTGGCGATCTGGAAGCTGAACCGTAGCGAAGGCGCTTCGCACTACTTTCTCGATCC
CGATGGCCACAAGCTGGAGCTGCACGTCGGCAGTCTCGCCCAGCGGCTGGCCGCCTGCCGCGAACAGCCGTATAAGGGGA
TGGTGTTTTTTGATCAGTGA

>>MEG_2992|Drugs|Fosfomycin|Fosfomycin_thiol_transferases|FOSA
ATGGAAATAACAAGTGTTAATCATATTTGTTTTTCAGTGAGTGATTTAAATACCTCTATACAATTTTATAAAGATATTTT
ACATGGTGACTTATTAGTATCAGGTAGAACGACAGCATATTTAACTATTGGTCATACTTGGATTGCACTGAATCAAGAAA
AAAATATACCAAGGAATGAAATAAGTCATTCCTATACGCACATTGCTTTCTCCATAGATGAAGAAGATTTTCAACAGTGG
ATTCAATGGCTTAAAGAGAATCAAGTAAATATTTTAAAAGGGCGACCAAGAGACATTAAAGACAAAAAATCGATATATTT
TACAGATCCGGATGGGCATAAAATTGAATTACATACTGGAACATTAAAAGATAGAATGGAATATTATAAATGTGAGAACA
CGCATATGCAATTTTACGATGAGTTTTGA

>>MEG_2993|Drugs|Fosfomycin|Fosfomycin_thiol_transferases|FOSA
ATGCTGAGTGGACTGAATCACCTGACCCTGGCAGTCAGCCAGCTGGCGCCGAGCGTGGCGTTTTATCAGCAGCTGCTGGG
CATGACGCTGCATGCCCGCTGGGACAGCGGGGCTTATCTCTCCTGCGGCGATTTGTGGCTGTGCCTGTCGCTGGATCCGC
AGCGGCGCGTTACTCCGCCGGAAGAGAGCGACTACACCCATTATGCGTTTAGTATTAGCGAAGCCGATTTTGCTAGCTTC
GCCGCCCGCCTTGAGGCTGCCGGCGTGGCGATCTGGAAGCTGAACCGTAGCGAAGGTGCCTCGCACTATTTCCTCGATCC
CGATGGCCATAAGCTGGAGCTGCACGTCGGCAGTCTCGCCCAGCGTCTGGCCGCCTGCCGCGAACAGCCGTATAAGGGGA
TGGTGTTTTTTGCTGAGTGA

>>MEG_2994|Drugs|Fosfomycin|Fosfomycin_thiol_transferases|FOSA
ATGCTGCAATCACTCAACCATCTGACCCTCGCGGTCAGCGACCTGCAAAAAAGCGTCACCTTCTGGCATGAGTTGCTGGG
GCTGACGCTGCACGCCCGCTGGAATACCGGGGCCTATCTCACCTGCGGCGATCTGTGGGTCTGCCTGTCGTACGACGAGG
CGCGCCAGTACGTGCCGCCGCAGGAGAGTGACTACACCCACTACGCGTTTACCGTGGCGGAAGAGGATTTTGAACCGCTC
TCGCAAAGGCTTGAGCAGGCGGGCGTCACCATCTGGAAGCAGAACAAAAGCGAGGGGGCGTCGTTCTATTTCCTCGACCC
GGACGGGCACAAGCTGGAGCTGCACGTGGGCAGCCTCGCCGCGCGGCTGGCGGCGTGTCGCGAGAAGCCCTATGCGGGCA
TGGTGTTTACCTCAGACGAGGCTTGA

>>MEG_2995|Drugs|Fosfomycin|Fosfomycin_thiol_transferases|FOSA
ATGCTGAGTGGACTGAATCACCTGACCCTGGCAGTCAGCCAGCTGGCGCCGAGCGTGGCGTTTTATCAGCAGCTGCTGGG
CATGATGCTGCATGCCCGCTGGGACAGCGGGGCTTATCTCTCCTGCGGCGATCTGTGGCTGTGCCTGTCGCTGGATCCGC
AGCGGCGCGTTACTCCGCCGGAAGAGAGCGACTACACCCATTATGCGTTTAGTATTAGCGAAGCCGATTTTGCTAGCTTC
GCCGCCCGCCTTGAGGCTGCCGGCGTAGCGGTCTGGAAGCTGAACCGTAGCGAAGGCGCTTCGCACTATTTCCTCGATCC
CGATGGCCATAAGCTGGAGCTGCACGTCGGCAGTCTCGCCCAGCGTCTGGCCGCCTGCCGCGAGCAGCCGTATAAGGGGA
TGGTGTTTTTTGCTGAGTGA

>>MEG_2996|Drugs|Fosfomycin|Fosfomycin_thiol_transferases|FOSA
ATGCTCACCGGTCTCAATCACCTGACCCTGGCGGTCGCCGATCTGCCGGCCAGCATCGCCTTCTACCGCGATCTTCTCGG
CTTTCGCCTGGAAGCGCGCTGGGACCAGGGCGCCTATCTCGAACTGGGTTCGCTGTGGCTGTGCCTGTCCCGGGAGCCGC
AGTACGGCGGGCCGGCCGCGGACTACACGCACTACGCCTTCGGCATCGCCGCCGCGGATTTCGCCCGCTTCGCCGCGCAG
CTGCGCGCGCATGGCGTGCGCGAATGGAAGCAGAACCGCAGCGAGGGCGATTCGTTCTACTTCCTCGACCCGGACGGCCA
TCGCCTGGAGGCCCACGTCGGCGACCTGCGCAGCCGGCTCGCGGCGTGCCGGCAAGCGCCCTATGCGGGAATGCGTTTCG
CCGACTAG

>>MEG_2997|Drugs|Fosfomycin|Fosfomycin_thiol_transferases|FOSA
ATGCAGTTATTAGGTTCAGTGGCTTCCCCTTTTGTTCGTCGTTTACGTTTAGTACTGGCAGGGCAACCTTATCAGTTTGT
AGCGCTTAATATTTTTGAGTCTGAAGGCCGTTCAGTGTTGGTACAACATAATCCGGCACGCAAAGTGCCTGTGTTAGTGG
ATGGAGAGCAGGTTATTTTTGATTCAGGCGTAATTTATCGTTATTTGGCTTCGAAACTGAAATTCAAACCATTGAGCTGG
GATCAGGAAAACGGTCTGACGACCATCAATGCCTGCACAGACTCCTTGGTTGAATTACTGCTTTGTAAGCGCTCAGGTTT
TGACGTGACTGAAGATAAATTGTTTTTTAATCTTCAGCATGAGCGAATTCAGGCGACGCTAGAGGCACTTGAGCAACAAA
TCAGGGCAGGGCATTTCGGTGACTGGGACTATCCTGGTATCAGTCTGTTCACTTTAATCGACTGGATATTGTTCCGCGAT
TTAGTCGACTTAAAACCCTTCCCTGTATTATTACAGTTCAGAAATGCGCATTTAAACCGGCCGATGGTCGCTGAAACCGA
CCCGCGTTTAAGCTAA

>>MEG_2998|Drugs|Fosfomycin|Fosfomycin_thiol_transferases|FOSA
ATGTTAAGCGGATTGAATCATCTGACCCTGGCGGTCAGCAGCCTGGCGCCGAGCGTGGCGTTTTATCACCAGCTGCTGGG
GATGACGCTGCACGCGCGCTGGGACGGCGGGGCCTATCTCTCCTGCGGCGATCTGTGGCTGTGCCTGTCGCTGGATCCGC
AGCGGCGCGTCACTCCGCCGGAAGAGAGCGACTATACCCACTACGCCTTTAGCGTCGCCGAAGCCGACTTCGCCGGGTTC
AGCGCGCGGCTGGAAACGGCCGGGGTGGCGGTGTGGAAGGTGAACCGCAGCGAAGGGGCGTCTTATTACTTCCTCGATCC
TGACGGCCACAAGCTGGAGCTGCACGTCGGCAGCCTCGCCCTGCGCCTGGCGGCGTGCCGCGAGCAGCCGTATAAAGGGA
TGGTGTTTTATGACGAGTGA

>>MEG_2999|Drugs|Fosfomycin|Fosfomycin_thiol_transferases|FOSA
ATGCTGCAATCCCTCAACCACCTGACCCTCGCGGTCAGCGACCTGCAAAAAAGCGTCACGTTCTGGCACGAGCTGCTGGG
GCTAGCGCTGTACGCCCGCTGGAATACCGGGGCCTATCTCACCTGCGGCGATCTCTGGGTCTGCCTGTCGTACGACGAGG
CGCGCCAGTACGTGCCGCCGCAGGAGAGCGACTACACCCACTACGCGTTTACCGTGGCGGAGGAGGATTTTGAACCGTTC
TCGCAAAGGCTTGAGCAGGCGGGCGTCACCGTCTGGAAGCAGAACAAAAGCGAGGGGGCGTCGTTCTATTTTCTCGACCC
GGACGGGCACAAGCTGGAGCTGCACGTGGGCAGCCTCGCCGCGCGGCTGGCGGCGTGTCGCGAGAAGCCCTACGCGGGCA
TGGTGTTTACCTCAGACGAGGCTTGA

>>MEG_3000|Drugs|Fosfomycin|Fosfomycin_thiol_transferases|FOSA
GTGATTTTAGGGCTCAACCATATAACCATTGCAGTTAGTGACTTAGAGCGCTCTCTTAAGTTTTATCGGGAGACGTTGGG
GTTCACTGCTCACGCTAAGTGGGACAACGGGGCTTACTTGTCGGTAGGTGAACTCTGGTTTTGCCTTTCTCACGATGAAC
CTTGCCCCAAAACCGACTATACCCACGTAGCTTTTGATATCGAACCAAAAGAATTTGAAGCCTTTGCGAAACGTGTAGTT
TCATTGGGTGTGGAAGTTTGGAAACAGAATAAGAGTGAAGGGCAGTCACTTTATATCTTAGACCCTGATGGTCATAAACT
AGAGATACACTCTGGCTCCCTTAAAAGCAGGTTAGAATCCCTAAGAACTAAGCTGTATAGTGGACTCGTTTGGCTTTAA

>>MEG_3001|Drugs|Fosfomycin|Fosfomycin_thiol_transferases|FOSA
ATGCTGAGTGGACTGAATCACCTGACCCTGGCAGTCAGCCAGCTGGCGCCGAGCGTGGCGTTTTATCAGCAGCTGCTGGG
CATGACGCTGCATGCCCGCTGGGACAGCGGGGCTTATCTCTCCTGCGGCGATTTGTGGCTGTGCCTGTCGCTGGATCCGC
AGCGGCGCGTTACTCCGCCGGACGAGAGCGACTACACCCATTATGCGTTTAGTATTAGCGAAGCCGATTTTGCTAGCTTC
GCCGTCCGCCTTGAGGCTGCCGGCGTGGCGATGTGGAAGCTGAACCGTAGCGAAGGTGCCTCGCACTACTTTCTCGACCC
CGACGGCCACAAGCTGGAGCTGCACGTCGGCAGTCTTGCCCAGCGGCTGGCCGCCTGCCGCGAACAGCCGTATAAGGGGA
TGGTGTTTTTTGATCAGTGA

>>MEG_3002|Drugs|Fosfomycin|Fosfomycin_thiol_transferases|FOSA
ATGCTGAGTGGACTGAATCACCTGACCCTGGCAGTCAGCCAGCTGGCGCCGAGCGTGGCGTTTTATCAGCAGCTGCTGGG
CATGACGCTGCATGCCCGCTGGGACAGCGGGGCTTATCTCTCCTGCGGCGATTTGTGGCTGTGCCTGTCGCTGGATCCGC
AGCGGCGCGTTACTCCGCCGGAAGAGAGCGACTACACCCATTATGCGTTTAGTATTAGCGAAGCCGATTTTGCTAGCTTC
GCCGCCCGCCTTGAGGCTGCCGGCGTGGCGATCTGGAAGCTGAACCGTAGCGAAGGTGCCTCGCACTATTTCCTCGATCC
CGATGGCCATAAGCTGGAGCTGCACGTCGGCAGTCTCGCCCAGCGTCTGGCCGCCTGCCGCGAACAGCAGTATAAGGGGA
TGGTGTTTTTTGATCAGTGAGCTTGCCGAATGA

>>MEG_3003|Drugs|Fosfomycin|Fosfomycin_thiol_transferases|FOSA
GGTTACCTGGAATGCGTCTGCACGCCCGTTGGGATAGCGGAGCATATCTTTCCTGCGGGGCGTTGTGGCTATGCTTGTCG
CTGGATGCGCAGCGGCGTAAAACGCCCGCTCAGGAAAGCGACTATACCCATTATGCTTTCAGCGTGGCGGAAGAGCACTT
TGCCGAGGTGGTCGCCCAGCTGGCGCACGCGGGGGCCGAAGTATGGAAAGACAACCGCAGCGAAGGGGCGTCGTACTATT
TTCTCGACCCTGACGGCCATAAGCTGGAACTGCATGTGGGTCATTTGGCACAGCGGCTGGCCGCCTGTCGGGAACGCCCG
TACAAGGGGATGGTCTTTTTTGACTGA