Warning: "continue" targeting switch is equivalent to "break". Did you mean to use "continue 2"? in /home/meglabuser/megares.meglab.org/vendor/doctrine/orm/lib/Doctrine/ORM/UnitOfWork.php on line 2640
MEGARes
MEGAResFrom MEG, the Microbial Ecology Group

Notice: Trying to access array offset on value of type null in /home/meglabuser/megares.meglab.org/vendor/doctrine/annotations/lib/Doctrine/Common/Annotations/DocParser.php on line 967

PTSL

The PTSL group of genes confer resistance to Fosfomycin through the mechanism, Fosfomycin target mutation.

References


    Deprecated: The behavior of unparenthesized expressions containing both '.' and '+'/'-' will change in PHP 8: '+'/'-' will take a higher precedence in /home/meglabuser/megares.meglab.org/src/Sequence.php on line 169

    Notice: Trying to access array offset on value of type null in /home/meglabuser/megares.meglab.org/vendor/doctrine/annotations/lib/Doctrine/Common/Annotations/DocParser.php on line 967

    Other Groups in Fosfomycin target mutation

    Sequences

    Download Sequences

    >>MEG_5819|Drugs|Fosfomycin|Fosfomycin_target_mutation|PTSL|RequiresSNPConfirmation
    ATGATTTCAGGCATTTTAGCATCCCCGGGTATCGCTTTCGGTAAAGCTCTGCTTCTGAAAGAAGACGAAATTGTCATTGA
    CCGGAAAAAAATTTCTGCCGACCAGGTTGATCAGGAAGTTGAACGTTTTCTGAGCGGTCGTGCCAAGGCATCAGCCCAGC
    TGGAAACGATCAAAACGAAAGCTGGTGAAACGTTCGGTGAAGAAAAAGAAGCCATCTTTGAAGGGCATATTATGCTGCTC
    GAAGATGAGGAGCTGGAGCAGGAAATCATAGCCCTGATTAAAGATAAGCACATGACAGCTGACGCAGCTGCTCATGAAGT
    TATCGAAGGTCAGGCTTCTGCCCTGGAAGAGCTGGATGATGAATACCTGAAAGAACGTGCGGCTGACGTACGTGATATCG
    GTAAGCGCCTGCTGCGCAACATCCTGGGCCTGAAGATTATCGACCTGAGCGCCATTCAGGATGAAGTCATTCTGGTTGCC
    GCTGACCTGACGCCGTCCGAAACCGCACAGCTGAACCTGAAGAAGGTGCTGGGTTTCATCACCGACGCGGGTGGCCGTAC
    TTCCCACACCTCTATCATGGCGCGTTCTCTGGAACTACCTGCTATCGTGGGTACCGGTAGCGTCACCTCTCAGGTGAAAA
    ATGACGACTATCTGATTCTGGATGCCGTAAATAATCAGGTTTACGTCAATCCAACCAACGAAGTTATTGATAAAATGCGC
    GCTGTTCAGGAGCAAGTGGCTTCTGAAAAAGCAGAGCTTGCTAAACTGAAAGATCTGCCAGCTATTACGCTGGACGGTCA
    CCAGGTAGAAGTATGCGCTAACATTGGTACGGTTCGTGACGTTGAAGGTGCAGAGCGTAACGGCGCTGAAGGCGTTGGTC
    TGTATCGTACTGAGTTCCTGTTCATGGACCGCGACGCACTGCCCACTGAAGAAGAACAGTTTGCTGCTTACAAAGCAGTG
    GCTGAAGCGTGTGGCTCGCAAGCGGTTATCGTTCGTACCATGGACATCGGCGGCGACAAAGAGCTGCCATACATGAACTT
    CCCGAAAGAAGAGAACCCGTTCCTCGGCTGGCGCGCTATCCGTATCGCGATGGATCGTAGAGAGATCCTGCGCGATCAGC
    TCCGCGCTATCCTGCGTGCCTCGGCTTTCGGTAAATTGCGCATTATGTTCCCGATGATCATCTCTGTTGAAGAAGTGCGT
    GCACTGCGCAAAGAGATCGAAATCTACAAACAGGAACTGCGCGACGAAGGTAAAGCGTTTGACGAGTCAATTGAAATCGG
    CGTAATGGTGGAAACACCGGCTGCCGCAACAATTGCACGTCATTTAGCCAAAGAAGTTGATTTCTTTAGTATCGGCACCA
    ATGATTTAACGCAGTACACTCTGGCAGTTGACCGTGGTAATGATATGATTTCACACCTTTACCAGCCAATGTCACCGTCC
    GTGCTGAACTTGATCAAGCAAGTTATTGATGCTTCTCATGCTGAAGGCAAATGGACTGGCATGTGTGGTGAGCTTGCTGG
    CGATGAACGTGCTACACTTCTGTTGCTGGGGATGGGTCTGGACGAATTCTCTATGAGCGCCATTTCTATCCCGCGCATTA
    AGAAGATTATCCGTAACACGAACTTCGAAGATGCGAAGGTGTTAGCAGAGCAGGCTCTTGCTCAACCGACAACGGACGAG
    TTAATGACGCTGGTTAACAAGTTCATTGAAGAAAAAACAATCTGCTAA