MEGAResFrom MEG, the Microbial Ecology Group

Notice: Trying to access array offset on value of type null in /home/meglabuser/megares.meglab.org/vendor/doctrine/annotations/lib/Doctrine/Common/Annotations/DocParser.php on line 967

FOMB

The fomB gene encodes an enzyme that phosphorylates the fosfomycin molecule, rendering it ineffective as an antibiotic.

References

  • http://pubs.acs.org/doi/abs/10.1021/bi2004334

Notice: Trying to access array offset on value of type null in /home/meglabuser/megares.meglab.org/vendor/doctrine/annotations/lib/Doctrine/Common/Annotations/DocParser.php on line 967

Other Groups in Fosfomycin phosphorylation

Sequences

Download Sequences

>>MEG_2974|Drugs|Fosfomycin|Fosfomycin_phosphorylation|FOMB
ATGCTGGAAAACCTCACGATCCGCAGCAGCCGCGTCGTCGACCTCAACCTGGTCAAGGTCAGGCTGTCCACCAACCTCGA
GGACTTCGCGGCGTACTCCTACTTCTCGGCCTTCGCCGAGGACGAGTCCGCGCCCGCCGACTACGAGGTCGTCTGCGTCG
ACCTGGACCGGGACGACATCCCGGCCGAGCTGTACGCCGACCGGACCGACCGGACCTTCCGCGGCAAGCGGTTCAAGGGC
GGCTACTACCTCGTCCACTACTTCGGGGAGCCCGCCCACCTCATCACGGTGGGCCGCACGTTCTACGTGTTCGGCAGGTC
CCTCGAGAAGACCGTCTGGCCCTACTTCGTCAAGCACATCCTGACCGTCCACTCCGCGGACCACGGCTTCCTGCACCTGA
AGGCGGCGGGCTTCGAACTGCCCGGCGCCGGAGCCACCCTGCTCGTCGGGCGCAACGGCGCGGGGAAGACCGTCTTCCTG
GCCCAGGCGTGCCTCAACGGCGCCCGGTTCCTCAGCAACACCCACACGCTGGTCCGGGACGGGGTCGCGCACGGCGTCCC
CTCCTCGATCCGGGTGCGCCGCGACCAGTGCTTCGGTGAACTCATCGACAAGCACGACCTGACGGCGCACATGGAGTCGG
GCGACTACGTCACCGACTCCTCGACTCTCTTCGAGAGTCCGCAGATCAGCACGGCACGCGTCCGGAACGTCGTCATCGTC
GACTACGACCCCGCACGCCCCCAGGGCCTCATGCCGATCTCGCCGGCCGCGGCCGGCACCTTCATGGAGCAGTTCTCCTT
CGCGGTCACCACCTACGGCCTCAAGGACGATCTGCTCGCCCACCACGGGGACTTCGACACCTACGTCGACTCCCTGGCCC
GGATGCGGGCGCAGCTGACCGAACTGGTCGAGGGCGCGCGCTGCTACCGGGCCAACGCAGACATGCTGGCCAAGGAAGTC
CGGGATTCGACGCTCAAGCAGCTTGCCGAATGA

>>MEG_2975|Drugs|Fosfomycin|Fosfomycin_phosphorylation|FOMB
ATGCTGGAAAACCTCACGATCCGCAGCAGCCGCGTCGTCGACCTCAACCTGGTCAAGGTCAGGCTGTCCACCAACCTCGA
GGACTTCGCGGCGTACTCCTACTTCTCGGCCTTCGCCGAGGACGAGTCCGCGCCCGCCGACTACGAGGTCGTCTGCGTCG
ACCTGGACCGGGACGACATCCCGGCCGAGCTGTACGCCGACCGGACCGACCGGACCTTCCGCGGCAAGCGGTTCAAGGGC
GGCTACTACCTCGTCCACTACTTCGGGGAGCCCGCCCACCTCATCACGGTGGGCCGCACGTTCTACGTGTTCGGCAGGTC
CCTCGAGAAGACCGTCTGGCCCTACTTCGTCAAGCACATCCTGACCGTCCACTCCGCGGACCACGGCTTCCTGCACCTGA
AGGCGGCGGGCTTCGAACTGCCCGGCGCCGGAGCCACCCTGCTCGTCGGGCGCAACGGCGCGGGGAAGACCGTCTTCCTG
GCCCAGGCGTGCCTCAACGGCGCCCGGTTCCTCAGCAACACCCACACGCTGGTCCGGGACGGGGTCGCGCACGGCGTCCC
CTCCTCGATCCGGGTGCGCCGCGACCAGTGCTTCGGTGAACTCATCGACAAGCACGACCTGACGGCGCACATGGAGTCGG
GCGACTACGTCACCGACTCCTCGACTCTCTTCGAGAGTCCGCAGATCAGCACGGCACGCGTCCGGAACGTCGTCATCGTC
GACTACGACCCCGCACGCCCCCAGGGCCTCATGCCGATCTCGCCGGCCGCGGCCGGCACCTTCATGGAGCAGTTCTCCTT
CGCGGTCACCACCTACGGCCTCAAGGACGATCTGCTCGCCCACCACGGGGACTTCGACACCTACGTCGACTCCCTGGCCC
GGATGCGGGCGCAGCTGACCGAACTGGTCGAGGGCGCGCGCTGCTACCGGGCCAACGCAGACATGCTGGCCAAGGAAGTC
CGGGATTCGACGCTCAAGCA