MEGAResFrom MEG, the Microbial Ecology Group

Notice: Trying to access array offset on value of type null in /home/meglabuser/megares.meglab.org/vendor/doctrine/annotations/lib/Doctrine/Common/Annotations/DocParser.php on line 967

MFPA

The mfpA gene encodes a protein that protects the DNA topoisomerases from the mechanism of action of the fluoroquinolone antibiotics. It's exact mechanism of action is not well described.

References

  • http://www.ncbi.nlm.nih.gov/pubmed/23275532

Notice: Trying to access array offset on value of type null in /home/meglabuser/megares.meglab.org/vendor/doctrine/annotations/lib/Doctrine/Common/Annotations/DocParser.php on line 967

Other Groups in Quinolone resistance protein Qnr

Sequences

Download Sequences

>>MEG_3942|Drugs|Fluoroquinolones|Quinolone_resistance_protein_Qnr|MFPA
TTGCAGCAGTGGGTTGATTGCGAATTCACCGGTCGAGACTTCCGCGACGAGGACCTTAGCCGCCTGCACACCGAACGGGC
GATGTTCAGCGAATGCGATTTCAGCGGCGTGAATCTGGCCGAGTCACAACACCGAGGGTCGGCGTTTCGTAATTGCACCT
TCGAACGGACGACACTGTGGCACAGCACATTTGCCCAGTGCAGCATGTTGGGCTCGGTCTTCGTGGCTTGCCGGCTGCGG
CCGCTGACGTTGGACGACGTGGATTTCACGCTCGCCGTGCTCGGCGGAAATGATCTGCGTGGTCTCAACTTGACCGGCTG
CCGGTTGCGAGAGACCAGCCTGGTGGATACCGACTTGCGCAAGTGCGTGCTGCGCGGCGCCGACCTCAGTGGTGCCCGTA
CCACGGGCGCCCGGCTGGATGACGCCGACTTGCGGGGCGCGACCGTGGACCCGGTATTGTGGCGGACCGCGTCGTTGGTG
GGTGCGCGTGTCGACGTCGACCAAGCCGTGGCCTTTGCGGCGGCGCACGGGCTGTGCTTGGCAGGGGGCTAG